RNU48 expression was used as an internal control. Beta-actin levels were used as loading control. All oligonucleotide transfection experiments PD332991 were performed in triplicate. For chromatin immunoprecipitation assays, chromatin fragments, derived from untreated, sicontrol- or siPD1-treated Jurkat cells, were immunoprecipitated with 8 g of antibody against STAT5 (ab7969, AbCam). DNA extraction was performed using Qiagen Purification Kit. Real-time PCR analysis was performed for miR-21 (forward: 5′-AGGGGACAAGTCAGAGAGAGG-3′ and reverse: 5′-TCCTCAGAGTAAGGTCA GCTCAG-3′. As a negative control, Jurkat cells were transfected with an siRNA against STAT5, resulting in inhibition

of STAT5 expression levels (90–95% decrease). Using these cells, ChIP was performed followed by PCR analysis. In addition, a positive control was used in the same experiment. Specifically, STAT5 ChIP was performed followed by PCR analysis for CISH (cytokine inducible SH2 protein) gene, a known direct target of STAT5 in human cells 40. The PCR primers used for CISH

were 5′-CTATTGGCC CTCCCCGAC-3′ (forward) and 5′-AGCTGCTGCC TAATCCTTTG-3′ (reverse). As a negative control, a noncontaining STAT5-binding site region was used. The PCR primers used were as follows: forward: 5′-GGTCAGGAGATTGGGA CCAT-3′ and reverse: 5′-TGTGCCTCCTGGGTTCAT-3′. The miRNA database miRBase (http://microrna.sanger.ac.uk/), the PicTar database (http://pictar.bio.nyu.edu/), and the TargetScan version 4.2 (http://www.targetscan.org/index.html) databases were used to identify the potential miRNA targets. In order to have more accurate prediction results, we chose the target genes LBH589 clinical trial that were predicted in two out of the three databases and were Interleukin-2 receptor conserved in other species. Jurkat cells were seeded in 24-well plates and were transfected using Lipofectamine 2000 (Invitrogen). Firefly luciferase reporter gene constructs containing the 3′UTR of PDCD4 (PDCD4-luc) were transfected together with 100 nM microRNA negative control or miR-21. Cell extracts were prepared 24 h after transfection, and the luciferase activity was measured using the Dual

Luciferase Reporter Assay System (Promega, WI, USA). Statistical analysis was performed using either ANOVA or the nonparametric Mann–Whitney U-test. Results were expressed as mean±SEM and p-values <0.05 were considered as statistically significant. The authors thank G. Bertsias for critical review of the manuscript, S. Jaeger for using bioinformatic tools to identify STAT5 sites in microRNA promoters and C. Choulaki for technical assistance. The authors acknowledge the Dana Farber Microarray Facility for performing the microRNA array experiments. This work was supported by the European Union’s Six Framework (FP6) Autocure project and the Hellenic Society of Rheumatology. Conflict of interest: The authors declare no financial or commercial conflict of interest.

Cells were analyzed on an FACSCanto (BD Biosciences), followed by analysis with FlowJo software (Tristar). Expression of γc in T cells was analyzed by Western blotting using a rabbit anti γc as first antibody (1:500; Santa Cruz) and a peroxidase-conjugated secondary antibody (1:6000; Amersham). Nuclear proteins were extracted from spleen CD3+ T cells and the amounts of activated NF-κB p65 subunit and NFATc1 were measured with commercial kits (Nuclear Extract Kit and TransAM™, Active Motif), according to the manufacturer’s instructions. Allograft-survival comparisons between

groups were analyzed using the log rank method. RT-PCR data were analyzed by the non-parametric Kruskal–Wallis and Mann–Whithney test. Other statistical analyses were performed Staurosporine using bilateral Student t test or ANOVA followed by protected least significance difference Fisher test when multiple groups were compared

(Statview). Results with p<0.05 were considered statistically significant. All values are means±SEM. This work was supported by the INSERM and by the Faculté de Médecine Pierre et Marie Curie. Additional support was provided by grants from the Association pour la Recherche sur le Cancer (No. 9946), the Ligue Nationale contre le Cancer (Comité de Paris), the Baxter Extramural Grant Program, and the Agence de la Biomédecine. E. L. was supported by grants from INSERM and Fondation pour la Roxadustat research buy Sclareol Recherche Médicale. C. D. C. was supported by the Else-Kröner-Fresenius Foundation. We thank Philippe Fontanges and Romain Morichon for confocal microscopy experiments, Olivier Lantz (Laboratoire d’Immunologie, INSERM U932, Institut Curie, Paris, France) for valuable discussions and all participating centers of the

European Renal cDNA Bank-Kroener-Fresenius biopsy bank (ERCB-KFB) and their patients for their cooperation. Conflict of interest: The authors declare no financial or commercial conflict of interest. “
“Although many case–control studies have investigated the association between P2X7 gene polymorphisms and tuberculosis susceptibility, the interpretation of these data has been difficult due to limited power. As a means of better understanding the link between P2X7 and tuberculosis, a systematic review of the literature was conducted using metaanalysis. This approach provided a quantitative summary estimate on the association between P2X7 and tuberculosis. We searched databases (MEDLINE, PUBMED, and OVID) between January 1998 and July 2010 using the search words ‘gene’ or ‘P2X7’ in combination with ‘tuberculosis,’ performed manual citation searches from relevant original studies and review articles and corresponded with researchers in the field of study. The pooled odds ratios (ORs) for studies examining variations in the P2X7 gene 1513 C and −762 C loci were 1.44 [95% confidence interval (CI) 1.23–1.68; P<0.

Therefore, in-vivo DC expansion system using such cytokines might not be preferable to examine the essential function of AZM in the present

report. However, our in-vivo this website data suggest that acute GVHD was clearly suppressed, clinically and pathologically, by oral AZM (Figs 1 and 2). It is tempting to speculate that AZM-treated DCs may be related functionally to regulatory DCs, not only in vitro but also in vivo, and might induce Treg in an allogeneic BMT setting. We are also interested in testing whether injection of AZM-treated DCs to recipients following allogeneic BMT could attenuate acute GVHD, as observed with regulatory DCs [38]. However, it might be difficult to develop and expand these DCs ex vivo. Simply administering AZM orally to recipients would be much more practical from the clinical viewpoint. Next, we confirmed the effects of AZM on donor lymphocytes. Tomazic et al. [44] reported that the absence of impairment of T and B lymphocytes by AZM might be an important property of this drug, especially in immunocompromised individuals. Our data for C57BL/6 murine lymphocytes are compatible with their results (Fig. 3). The fact that AZM has no deleterious effects on T lymphocyte functions in this setting

is important for preservation of the graft-versus-leukaemia (GVL) effect of AZM therapy. Conversely, commonly used immunosuppressants such as tacrolimus (a 23-membered ring-macrolide) and cyclosporin inhibit T lymphocyte functions strongly by blocking the phosphatase activity of calcineurin, resulting in susceptibility to infections and a Cabozantinib price decreased GVL effect. Moreover, potential concerns for the use of these calcineurin inhibitors include renal toxicity, veno-occlusive disease of the liver, hypertension, hyperglycaemia and neurological side effects [45]. In contrast, AZM has been used safely worldwide as an antibiotic. Nevertheless, AZM is not without its own safety issues: reversible hearing

loss with high doses (600 mg daily for 1·5–20 weeks) [46] and long-term treatment (600 mg once weekly for 1 year) [47] and cardiovascular effects; specifically, prolongation of the QT interval that leads to torsades de pointes, an abnormal heart rhythm that can be fatal [48]. In addition to the immunoregulatory effects of AZM, its anti-microbial find more effect may also be important in BMT as bacteria and bacterial products, especially LPS, are associated with exacerbation of GVHD [49, 50]. In the clinical setting, Gram-negative gut decontamination has actually been found to reduce the incidence of GVHD [51-53]. Interestingly, some investigators reported that changes in the microbial flora, due to intestinal inflammation caused by TBI as preconditioning for murine recipients of allogeneic BMT, influenced the severity of acute GVHD, and that manipulation of the intestinal flora enabled regulation of acute GVHD [53, 54].

After washing, 5 × 104–1 × 105 NK T cell hybridomas were cultured in the plate for 16–20 h, and IL-2 in the supernatant was measured by ELISA (BD PharMingen, San Diego, CA, USA). Liver tissues were

collected immediately from animals upon killing, fixed in 4% paraformaldehyde, embedded in paraffin, cut into 4-μm sections, deparaffinized, stained with haematoxylin EPZ015666 chemical structure and eosin (H&E) and evaluated using light microscopy [36]. Scoring of liver inflammation was performed on coded H&E-stained sections of liver using a set of three indices by a ‘blinded’ pathologist (K.T.); indices including degrees of portal inflammation, parenchymal inflammation and bile duct damage were scored as: 0 = normal, no inflammation (or bile duct damage); 1 = minimal inflammation (or bile duct damage); 2 = mild inflammation (or bile duct damage); 3 = moderate inflammation (or bile duct damage); and 4 = severe inflammation (or bile duct damage). To examine the bile duct pathology, immunochemical staining was performed with a rabbit polyclonal antibody for cytokeratin

(CK) 19, which is an established marker Protein Tyrosine Kinase inhibitor of biliary epithelial cells. Liver sections were immunostained using standard microwave protocol, as described previously [37]. In brief, after deparaffinization and microwave heating for antigen retrieval, rabbit polyclonal antibody against CK19 (Novus Biologicals, Littleton, CO, USA) was applied and incubated under intermittent microwave irradiation. After rinsing with TBS, Envision-peroxidase for rabbit polyclonal antibodies (Dako, Carpenteria, CA, USA) was applied and incubated under intermittent microwave treatment. As a substrate of peroxidase, 3,3′-diaminobenzidine (DAB; Vector, Burlingame, CA, USA) was applied for 5 min. Heamatoxylin was used as a counter-stain. Data are presented as the mean ± standard error of the mean (s.e.m.). Dichloromethane dehalogenase Two-sample comparisons were analysed using the two-tailed unpaired t-test.

The correlation between two parameters was analysed using Spearman’s correlation method. A value of P < 0·05 was considered statistically significant. As shown in Fig. 2a, the levels of anti-PDC-E2, measured as OD values in ELISA using 1:500 diluted serum samples, were significantly higher (P < 0·001) in E. coli-infected mice 4–12 weeks after bacterium infection when compared with the N. aro-infected mice and the uninfected control group. The level of anti-PDC-E2 peaked at 4 weeks after E. coli infection and then gradually decreased to the same level as that of N. aro-infected mice. Anti-PDC-E2 and anti-OGDC-E2 antibodies were detected in the serum of E. coli-infected mice but not N. aro-infected mice, while anti-BCOADC-E2 antibodies were not detected in either group (Fig. 2b). Next we validated the specificity of AMA by immunoblotting, which confirmed the presence of anti PDC-E2 antibodies in both E. coli- and N. aro-infected mice but not in control mice (Fig. 2c).

Briefly, CD4+ CD25− T cells (104 cells in 100 μl of medium) were seeded into a 96-well culture plate, preincubated for 60 min with nIL-2, BMS-345541, PS-1145 or vehicles, added with 20 μl of BrdU label (1 : 2000) in fresh medium, activated by the addition of MACS iBeads particles loaded with anti-CD3 plus anti-CD28 monoclonal antibodies, and maintained at 37° in a 5% CO2 humidified atmosphere for the indicated times (see results).

In controls, BrdU label was omitted. After incubation, cells were treated with fixative/denaturing solution and incubated with anti-BrdU monoclonal antibody. Unbound antibody was removed by washing and goat anti-mouse HRP-conjugate was added. Following extensive washing, fluorogenic substrate Bcl-2 inhibitor was added and fluorescent product intensity

measured check details at 355 nm (excitation) and 444 nm (emission) using a Fluoroskan Ascent-Thermo microplate fluorometer (Thermo Fisher Scientific, MA). Data are the ratio of the signals obtained from the labelled (BrdU) sample to those obtained from the unlabelled sample (no BrdU) after subtraction of endogenous fluorescence. For CD4 and CD25 expression analysis, cells were washed with PBS supplemented with 0·5% bovine serum albumin (BSA) (A3156; Sigma-Aldrich) and stained for 20 min at 4° with fluorescein isothiocyanate (FITC)-conjugated anti-CD4, phycoerythrin (PE)-conjugated anti-CD25 (Becton-Dickinson, Idoxuridine NJ) and Cy-5-conjugated anti-CD3 (Caltag Laboratories, Burlingame, CA) with appropriate isotype control. Cells were washed, resuspended in PBS/BSA and analysed using an EPICS XL Beckman-Coulter, CA flow cytometer. Analysis of DNA content was carried out using propidium iodide staining. Briefly, naïve CD4+ CD25− T cells (1 × 106) were pretreated for 1 hr with DMSO, 3 μm BMS-345541 or 3 μm PS-1145 and then stimulated for 24 hr with anti-CD3 plus anti-CD28 antibodies. After treatment, cells were washed in PBS and fixed on ice with 70% volume/volume (v/v) cold ethanol to a final concentration of 65% v/v. Fixed

cells were washed in PBS, resuspended in propidium iodide (PI) solution (20 μg/ml PBS) containing DNase free RNase A (50 μg/ml PBS), incubated for 30 min at room temperature in the dark and analysed by flow cytometry.28 Cultured cells (3 × 106) were washed with PBS at 4° and extracted on ice in 50 μl of RIPA buffer [50 mm Tris-HCl, pH 7·4, 150 mm NaCl, 1% v/v Triton X-100, 0·25% weight/volume (w/v) sodium deoxycholate, 1 mm ethylenediaminetetraacetic acid (EDTA), 1 mm NaF, 1 mm Na3VO4 and 1 mm Na4P2O7] containing 1% v/v protease inhibitor cocktail. Lysate was centrifuged at 18 000 g for 5 min at 4°, and the supernatant was collected and stored at −80°. Protein concentration was determined using the DC Protein Assay kit.

However,

reproducibility is poor (CV are 45% or higher) when peak perfusion is expressed as a function of baseline [114,133]. Most of the studies exploring PORH reproducibility have been performed on the volar surface of the forearm, and results are conflicting. Reproducibility was excellent (CV from 6% to 22%) when the locations of the laser probes were marked so that exactly the same sites were studied from one day to another [148]. However, reproducibility was only Dorsomorphin molecular weight fair to good (CV around 20%) when the position of the probe was recorded with less precision [2] and decidedly poor when the skin sites were randomly chosen (CV were 40% or higher) [114]. As temperature plays a key role in baseline flux, it is not surprising that homogenizing skin temperature when performing PORH assessed with single-point LDF improved reproducibility on the forearm, especially when data were expressed as a function of baseline. Maintaining skin temperature at 33°C

throughout the recording provided acceptable one-week reproducibility, whether expressed as peak CVC or as a function of baseline (CV were 33% or lower) [117]. However, skin temperature homogenization only partially compensates for spatial variability, as the inter-site reproducibility of simultaneous PORH measurements on the forearm was poor compared with that of full-field techniques [117]. Selleckchem EX-527 Therefore, it is likely that the variation in capillary density between different skin sites is the major source of variability when using single-point Paclitaxel research buy LDF. The use of full-field techniques such as LDI could lessen this variability. However, LDI is not fast enough to accurately assess the kinetics of PORH (which lasts only a few seconds) over large areas, resulting in a potential shift of the recorded peak compared with the peak measured with LDF. However, some groups have successfully used LDI to assess PORH by studying very small areas, scanning up to 20 images/min with good reproducibility (CV ranging between 10% and 15%) [79]. Nevertheless, the major advantage of LDI (spatial resolution over large areas) is lost. Line scanning

LDI may be another way of overcoming this issue. Moreover, the recently developed high frame rate LSCI technique allows continuous assessment of skin perfusion over wide areas, and could combine the advantages of both LDF and LDI [117]. Another issue when comparing protocols that use PORH is the heterogeneity of study designs. Indeed, there is no consensus about the optimum protocol, and a wide variety in the duration of brachial artery occlusion exists, from 1 to 15 minutes, with a positive relationship between post-occlusive hyperemic response and the duration of arterial occlusion [79,145,149]. Occlusion lasting five minutes has been extensively used, probably from analogy with brachial artery flow-mediated dilation methods, a standardized tool used to investigate endothelial function in conduit arteries [23].

One candidate upstream component is the leucine-rich repeat (LRR)-containing G-protein-coupled receptor (GPCR) follicle-stimulating hormone receptor (FSHR-1), which was identified in a limited reverse mTOR inhibitor genetic screen of 14 candidate transmembrane LRR receptors in C. elegans. RNAi directed against fshr-1 results in a high degree of susceptibility to killing by P. aeruginosa, Staphylococcus aureus and Enterococcus faecalis, but not in a reduced lifespan during infection by non-pathogenic E. coli[24]. Expression of FSHR-1 in intestinal cells is necessary and sufficient for its role in innate immunity. Genetic analysis

indicates that FSHR-1 functions in the intestine in a separate pathway from PMK-1 and DAF-2, the worm insulin receptor that is involved in stress responses (see below) [24]. Further, qRT–PCR analysis shows that FSHR-1 and the PMK-1/p38 MAPK cassette regulate the induction of overlapping, but non-identical, sets of P. aeruginosa-induced genes. Although transcriptional profiling data suggest that FSHR-1 regulates host response genes independently of PMK-1, it is unclear whether the PMK-1/p38 MAPK cassette may be involved partially in signal transduction downstream of FSHR-1 [24].

It is also possible that the FSHR-1 and PMK-1/p38 MAPK pathways function Decitabine ic50 in parallel but converge on common sets of target genes in response to pathogen infection. How is FSHR-1 involved in mediating the C. elegans host response? check details We currently lack evidence that FSHR-1 can sense infection directly, for instance by binding pathogen-associated molecular patterns (PAMPs). FSHR-1 is the sole C. elegans LGR-type

GPCR. In mammals the heterodimeric glycopeptide hormone FSHα/β is the canonical ligand for this class of GPCR. Worms do not have an identifiable FSHα subunit and the endogenous ligands, if any, have not been identified. As an LGR-type receptor, one might expect FSHR-1 to transduce signals through heterotrimeric G-proteins in the intestinal cell. Recent findings implicate at least one heterotrimeric G-protein in signal transduction events upstream of PMK-1 in a different tissue, the hypodermis (see below). Whether this or other G-proteins mediate FSHR-1 signal transduction in the intestine remains unknown. Recent findings show that the protein kinase Cδ (PKCδ) TPA-1 activates the protein kinase D DKF-2 upstream of PMK-1/p38 in the intestine [20]. The upstream signals that control TPA-1 activity remain unknown, although by analogy with other systems, a likely candidate is diacylglycerol (DAG, produced by phospholipase C).

Cells were maintained in Dulbecco’s modified Eagle’s minimal essential medium (Invitrogen, Frederick, MD) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Stat1 constructs (Stat1α and Stat1β) were a kind gift from Dr D. Levy, New York University Medical Center, NY. Stat1α-Y701F, Stat1α-S727A, Stat1α-Y701F/S727A and Stat1β-Y701F were ZD1839 generated by site-directed mutagenesis using the QuikChange mutagenesis

kit (Agilent, Santa Clara, CA). Constructs were subcloned into the pcDNA 3.1+ plasmid which carries the hygromycin resistance gene (Invitrogen). Transfections were carried out using Lipofectamine LTX (Invitrogen) according to the manufacturer’s protocols. Stable transfectants were selected and maintained in medium supplemented with 400 μg/ml of hygromycin (Invitrogen). All constructs were verified by sequencing (Genewiz, South Plainfield, NJ). Cells were stimulated with mouse IFN-γ (100 μ/ml; Peprotech, Rocky Hill, NJ) for 24 hr and whole-cell protein extracts were prepared with the addition of protease inhibitors (Roche Diagnostics, Nutley, NJ) and phosphatase

inhibitor cocktails 1 and 2 (Sigma-Aldrich, St. Louis, MO). Protein quantification was carried out using the bicinchoninic acid (BCA) assay (Pierce, Rockford, IL). For Western blotting to detect GILT protein, 5 μg/lane of protein extract was loaded onto 15% sodium dodecyl sulphate (SDS)-polyacrylamide gels. Proteins were transferred onto poly(vinylidene difluoride) BKM120 mouse (PVDF) membranes. Primary antibodies used for detection were GILT (rabbit polyclonal antiserum; M. Maric), actin (Sigma-Aldrich), total STAT1 Dichloromethane dehalogenase (Cell Signaling, Danvers, MA). Anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody (Jackson Immunoresearch, West Grove, PA) was used. Detection was carried out using the ECL plus reagent (PerkinElmer,

Gwaitham, MA). The sequences of the 5′ biotinylated oligonucleotides (IDT, San Diego, CA) used for the DNA affinity precipitation assay (DAPA) were as follows: STAT1 GAS Site Probe 1, GCGGAGCCTTCAGGAAAGGAGTCCCAGG and STAT1 GAS Site Probe 2, CACACTCAGTTGCTGGAAGCAAGTACCTCA; and the non-biotinylated oligonucleotides used were Stat1 consensus, TCGAGCCTGATTTCC-CCGAAATGAGGC and p53, TCCGAACAAGTCCGGGCATATGT. Complementary oligonucleotides were mixed with the above-mentioned sequences and annealed. Five-hundred micrograms of whole-cell lysate was incubated with 900 pmol of biotinylated oligonucleotide, and the complex was immunoprecipitated using streptavidin-conjugated agarose beads (Millipore, Temecula, CA), based on a previously described protocol.12 Oligonucleotide competition assays were performed using either a 10-fold or a 50-fold excess of nonbiotinylated DNA oligonucleotides. Proteins were eluted from streptavidin-conjugated agarose beads and analyzed by Western blotting, after SDS-PAGE (12% gel).

Since thymic MDCs are not available from study participants we measured surface expression of TSLPR on peripheral blood CD11+ MDCs which were previously shown to induce ex RGFP966 mouse vivo differentiation of Treg from CD4+CD8−CD25− naïve thymocytes following activation with TSLP 13. IL-7Rα surface expression levels on total CD4+ T cells and T-cell subsets were determined

by measuring the CD127-mean fluorescence intensity (MFI) using flow cytometric analysis (shown in Fig. 1). Highest surface expression levels of IL-7Rα were observed on Tconv with a memory phenotype, whereas IL-7Rα-MFIs on Tconv exhibiting either a naïve or a RTE phenotype were consistently ∼20% lower in both study cohorts. IL-7Rα-MFIs correlated highly between different Tconv subsets in all blood samples tested (Pearson’s correlation coefficient r2 ranged between 0.90 and 1.00 for all subsets, not depicted). Overall, IL-7Rα-MFIs of total Tconv and Tconv subsets were significantly

reduced in MS patients (n=56) versus age- and sex-matched control donors (n=33) (total Tconv: HC 309.2±45.7, MS 221.8±77.9; p<0.001; memory-Tconv: HC 353.1±52.7, MS 227.6±85.3; p<0.001; naïve Tconv: HC 284.5±39.9, MS 184.4±65.7; p<0.001; RTE-Tconv: HC 286.7±39.9, MS 191.0±67.0; p<0.001; Fig. 2A). Treg and Treg subsets invariably exhibited low surface expression levels of IL-7Rα in all samples analyzed (data not shown). CD25 expression of Tconv learn more and Tconv subsets did not differ between Cobimetinib research buy both study cohorts (data not shown). In concordance with our previous findings, frequencies of Tconv and Treg exhibiting a naïve phenotype were clearly reduced in MS patients as compared to age- and sex-matched control

sonors, whereas memory cells were expanded (data not shown). In both study cohorts numbers of Tconv and Treg with a naïve or RTE phenotype strongly correlated with IL-7Rα surface expression levels on total Tconv and Tconv subsets. Highest correlations were observable, when frequencies of RTE-Tconv and RTE-Treg were plotted against IL-7Rα-MFIs on total Tconv (RTE-Tconv: HC: r2=0.112, MS: r2=0.184; RTE-Treg: HC: r2=0.173, MS: r2=0.341; shown for RTE-Treg in Fig. 2B). All correlations were statistically significant with p<0.05). IL-7Rα-MFIs and RTE-frequencies decreased with age in healthy donors (IL-7Rα-MFI on Tconv: r2=0.190, RTE-Tconv: r2=0.473, RTE-Treg: r2=0.393) but were both independent of age in MS patients. Total Treg and Tconv were immunomagnetically separated from peripheral blood samples of 15 patients and 15 age- and sex-matched control donors and suppressive activities of Treg were determined by in vitro proliferation assays. As expected, and previously shown 2, the mean Treg-mediated suppression of Tconv proliferation was significantly reduced in MS (HC: 59.1±21.9%, MS: 30.6±21.6%, p<0.

Data were expressed as mean and standard error of the mean and analysed by anova followed by Tukey’s multiple comparison test to compare the statistical significance of the observed differences between the groups. Whenever there was a significant difference, t-test was used to compare individual groups. Analysis was carried out using SigmaStat 2.0 software (Jandel GmbH, Erkrath, Germany). P < 0·05 was considered significant. Analysis of the isolates collected from four endemic areas of L. major by SSCP

showed distinctive profiles among the four isolates. Isolates displayed genotypically different patterns with each other, even with RS of L. major, as displayed in Fig. 1. The characteristics of four strains are demonstrated in Table 1. As shown in Table 1, different strains see more showed distinct patterns of the parasite burden 8 weeks post-infection. The lowest number of the viable parasites was detected in LN of mice, infected with DA39 strain (2.15 × 107 ± 2.26 × 106), and the highest number was documented for SH25 strain (9.59 × 109 ± 3.82 × 109). A statistically significant difference was observed in the parasite load caused by DA39 strain, compared with KA1, SH25 and DE5 strains (P ≤ 0·001 for all comparisons) at 8 weeks post-infection. The expression of Ifng mRNA in LN of mice inoculated by all strains was detected at early phases

of the infection, namely within 3, 16 and 40 h (the highest level) post-infection. Amongst the four strains,

clonidine DA39 strain showed the highest FI in mRNA expression at 16 h (33 FI) and peaked to the highest level of Ifng transcript expression at www.selleckchem.com/products/E7080.html 40 h (127 FI) post-infection. The differences with other strains were significant (P < 0·001, for all comparisons). Likewise, after DA39 strain, the SH25 strain showed a higher level of FI (56 FI) compared with the other strains at 40 h post-infection (P < 0·001). Although the level of Ifng mRNA elicited in LN of the infected mice by all strains was decreased in the late phase, both DA39 and SH25 strains showed significantly higher FI (16 and 13 FI, respectively) than the other strains at W3 post-infection (P < 0·001 for all comparisons), and the difference between DA39 and SH25 strains was significant (P = 0·035) (Fig. 2a). In week 8, DA39 showed significant difference only with the RS (P < 0·001), but no significant differences were detected with other strains. The expression of Il2 mRNA in draining LN of the infected mice was high in the early phase of the infection including 3 h (35–65 FI) and 16 h (26–74 FI), and highest level was observed at 40 h (45–113 FI) post-infection. Amongst the four strains, DA39 strain showed the highest level of transcript expression (113 FI) at 40 h post-infection, followed by SH25, KA1, DE5 and RS strains. Statistically significant difference was observed in Il2 mRNA FI induced by DA39 with KA1, SH25 and DE strains (P < 0·001 for all comparisons) at this time point.