In addition to possible direct effects due to the presence of the vitamin D receptor and of the 1-alpha hydroxylase enzyme in cardiac myocytes and other cells of the cardiovascular system [79], vitamin D has significant effects on several cardiovascular risk factors. Studies, ranging from animal Go6983 clinical trial studies to clinical trials, have shown that pharmacological doses of vitamin D notably reduce inflammation [80], improve endothelial function [81], control the secretion of insulin and improve insulin sensitivity [82]. Furthermore, as recently reviewed, vitamin D status has been linked to arterial hypertension [83].

Several observational studies suggest that 25(OH) vitamin D levels less than 15 ng/ml are associated with an excess risk of cardiovascular events when compared to levels >30–40 ng/ml. A nested case–control study in 18,225 men in the Health Professionals

Follow-up Study (men selleck inhibitor aged 40–75 years, free of cardiovascular disease at baseline) showed that men with a 25(OH) vitamin D level ≤15 ng/ml had an increased risk for myocardial infarction relative to men with a level ≥30 ng/ml (RR 2.42; 95% CI 1.35–3.84) [84]. Even men with a 25(OH) vitamin D level 22.6–29.9 ng/ml had an increased risk (RR 1.60; 95% CI 1.10–2.32) compared with those with a level ≥30 ng/ml. In the Framingham offspring cohort study, 25(OH) vitamin D was measured in 1,739 participants without prior heart disease. At a mean follow-up of 5.4 years, amongst those with AZD4547 datasheet hypertension, there was a 2-fold increase in the risk of cardiovascular events for the participants with a 25(OH) vitamin D level <15 ng/ml compared to those with a level ≥15 ng/ml

[34]. The Ludwigshafen Risk Ixazomib in vivo and Cardiovascular Health Study, a prospective cohort comprising 3,300 patients referred to coronary angiography and followed for 7.7 years, demonstrated a strong association between vitamin D status and several cardiovascular outcomes, such as cardiovascular mortality [85], stroke [86], heart failure and sudden cardiac death with the lowest risk amongst those with the highest 25(OH) vitamin D levels [87]. However, such associations have not been found in other studies. In the Osteoporotic Fractures in Men Study, vitamin D intake was evaluated in 3,094 men and 25(OH) vitamin D was measured in 813 men. The authors found no association between vitamin D intake or 25(OH) vitamin D levels and incidence of cardiovascular disease during a median follow-up of 4.4 years [88]. Similarly, serum levels of 25(OH) vitamin D levels were not independently associated with cardiovascular mortality in the prospective Rancho Bernardo study including 1,073 community-dwelling older adults followed up to 10.4 years [89]. On the other hand, in a cross-sectional study of 2,722 subjects, the prevalence of hypertension was found to be increased in subjects with 25(OH) vitamin D levels <40 ng/ml; odds ratios were 2.7 (1.4–5.2), 2.0 (1.4–5.2) and 1.3 (1.2–1.

Romanova NA, Brovko LY, Moore L, Pometun E, Savitsky AP, Ugarova NN, et al.: Assessment of photodynamic destruction of Escherichia coli O157:H7 and Listeria monocytogenes by using ATP bioluminescence. Appl Environ Microbiol 2003, 69:6393–6398.HDAC inhibitor PubMedCrossRef 38. Sharma M, Visai L, Bragheri F, Cristiani I, Gupta PK, Speziale P: Toluidine blue-mediated photodynamic

effects on staphylococcal biofilms. Antimicrob Agents Chemother 2008, 52:299–305.PubMedCrossRef 39. Grinholc M, Szramka B, Olender K, Graczyk A: Bactericidal effect ACY-738 mouse of photodynamic therapy against methicillin-resistant Staphylococcus aureus strain with the use of various porphyrin photosensitizers. Acta Biochim Pol 2007, 54:665–670.PubMed 40. Brunet L, Lyon DY, Hotze EM, Alvarez PJ, Wiesner MR: Comparative photoactivity and antibacterial properties of C60 fullerenes and titanium dioxide nanoparticles. Environ Neuronal Signaling Sci Technol 2009, 43:4355–4360.PubMedCrossRef

41. Horsburgh MJ, Ingham E, Foster SJ: In Staphylococcus aureus, fur is an interactive regulator with PerR, contributes to virulence, and Is necessary for oxidative stress resistance through positive regulation of catalase and iron homeostasis. J Bacteriol 2001, 183:468–475.PubMedCrossRef 42. Ballal A, Manna AC: Regulation of superoxide dismutase (sod) genes by SarA in Staphylococcus aureus. J Bacteriol 2009, 191:3301–3310.PubMedCrossRef 43. Embleton ML, Nair SP, Heywood W, Menon DC, Cookson BD, Wilson M: Development of a novel targeting system for lethal photosensitization of antibiotic-resistant strains of Staphylococcus aureus. Antimicrob Agents Chemother 2005, 49:3690–3696.PubMedCrossRef 44. Lambrechts SA, Demidova TN, Aalders MC, Hasan T, Hamblin MR: Photodynamic therapy for Staphylococcus aureus infected burn wounds in mice. Photochem Photobiol Sci 2005, 4:503–509.PubMedCrossRef 45. Omar GS, Wilson M, Nair SP: Lethal photosensitization of wound-associated microbes using indocyanine green and near-infrared light. BMC Microbiol 2008, 8:111.PubMedCrossRef 46. Jurczak A, Szramka B, Grinholc M, Legendziewicz J, Bielawski KP: Photodynamic effect of lanthanide derivatives

of meso-tetra(N-methyl-4-pyridyl)porphine against Staphylococcus Decitabine nmr aureus. Acta Biochim Pol 2008, 55:581–585.PubMed 47. Grinholc M, Kawiak A, Kurlenda J, Graczyk A, Bielawski KP: Photodynamic effect of protoporphyrin diarginate (PPArg2) on methicillin-resistant Staphylococcus aureus and human dermal fibroblasts. Acta Biochim Pol 2008, 55:85–90.PubMed 48. Gad F, Zahra T, Hasan T, Hamblin MR: Effects of growth phase and extracellular slime on photodynamic inactivation of gram-positive pathogenic bacteria. Antimicrob Agents Chemother 2004, 48:2173–2178.PubMedCrossRef 49. Tegos GP, Masago K, Aziz F, Higginbotham A, Stermitz FR, Hamblin MR: Inhibitors of bacterial multidrug efflux pumps potentiate antimicrobial photoinactivation. Antimicrob Agents Chemother 2008, 52:3202–3209.PubMedCrossRef 50.

Conclusions Insect-associated microbiota can be difficult to classify using existing

databases [15]; The lack of cultured isolates or characterized species from insect environments and also the enormous diversity of hosts for the microbial communities is problematic. For example, when predefined, publically available datasets are used to train the RDP-NBC and classify sequences from the honey bee gut, an environment for which there are no cultured representatives, taxonomic classifications are unstable and inconsistent (Figure 2A). In contrast, the HBDB custom training sets effectively and confidently classify the bacteria in the honey bee gut. Results from our classification are consistent with previous studies of the honey bee gut using 16S rRNA clone libraries [17, 18], suggesting that the inclusion

of environment-specific, high-quality, BIBW2992 cell line full-length sequences in the training set can dramatically affect the classification results produced by the RDP-NBC. In addition, the larger, more diverse training sets (SILVA + bees and GG + bees), provided more stable and precise classifications, echoing results of previous studies and suggesting that breadth and depth in the RDP-NBC training set is crucial for more confident taxonomic classifications [11]. This result echoes those of other groups who have found that representation in training sets markedly affects RDP-NBC ACY-1215 purchase performance [11, 29]. Acknowledgements This work was funded by startup funds provided by Indiana University to ILGN. The manuscript benefited from the

critiques of four anonymous reviewers, to which we are thankful. Electronic supplementary material Additional file 1: Table S1. Total number of operational taxonomic units (97% ID) in either genetically uniform or genetically diverse colonies and classified as one of Mannose-binding protein-associated serine protease the honey bee specific taxonomic groups. (DOCX 48 KB) Additional file 2: Table S2. Top scoring blastn hits between full-length, bee specific sequences and the Greengenes training set. (XLSX 46 KB) Additional file 3: Figure S1. Phylogenetic placement of representative short read classified as Orbus by the RDP + bees training set. (DOCX 271 KB) References 1. Andersson AF, Lindberg M, Jakobsson H, Backhed F, Nyren P, Engstrand L: Comparative Analysis of Human Gut Microbiota by Barcoded Pyrosequencing. PLoS One 2008,3(7):e2836.PubMedCrossRef 2. Bates ST, Berg-Lyons D, Caporaso JG, Walters WA, Knight R, Fierer N: Examining the global Selleck VE822 distribution of dominant archaeal populations in soil. ISME J 2011,5(5):908–917.PubMedCrossRef 3. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA, Turnbaugh PJ, Fierer N, Knight R: Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. P Natl Acad Sci USA 2011, 108:4516–4522.CrossRef 4.

J Am Chem Soc 2012, 134:3419–3428.CrossRef 32. Wang YD, Wu MX, Lin X, Shi ZC, Hagfeldt A, Ma TL: Several highly efficient catalysts for Pt-free and FTO-free counter electrodes of dye-sensitized ZD1839 clinical trial solar cells. J Mater Chem

2012, 22:4009–4014.CrossRef Competing interests The MK0683 supplier Authors declare that they have no competing interests. Authors’ contributions JK carried out the experiments, characterization, and acquisition of data. ZJZ participated in the designing of the experiments, experiment analysis, interpretation of data, and language modification. ML and WHZ carried out the sample preparation and measurements. SJY, RYY, and YZ participated in the discussion. SXW is the investigator who helped in the analysis and interpretation of data, drafting of the manuscript, and revisions. All authors read and approved the final manuscript.”
“Background Silicon nanowires (SiNWs) attract significant attention because of their potential MX69 research buy applications in many fields like sensors, transistors, lithium batteries, diodes, and photovoltaics [1–5]. Particularly, they can be applied on silicon solar cells as an antireflection coating, due to low average reflectance values [6, 7]. Several synthesis methods have been used to

fabricate SiNWs including chemical vapor deposition [8], laser ablation [9], thermal evaporation, and solution methods [10–12]. Among these synthesis methods, wet chemical etching has been frequently used to prepare SiNWs. Metal-assisted wet chemical etching is advantageous click here for achieving SiNWs with controlled diameter,

length, spacing, and density, avoiding expensive and low-throughput usual lithographic processes [13]. Recently, it has been shown that a silicon nanowire antireflection coating (ARC) prepared by metal-assisted wet chemical etching is a near-perfect antireflection coating [14]. The superior antireflection property of the nanowire surface is attributed to three reasons: huge surface area of SiNWs, rough surface morphology which leads to strong light scattering as well as absorption, and graded refractive index profile between air and SiNWs that closely implies a multilayer antireflection coating [6, 14, 15]. Some other properties of SiNWs, for example, crystal ordination, good doping level, and excellent uniformity, imply appropriate utilization of SiNWs in silicon solar cells. Despite all these features, the maximum efficiency of planar solar cells using SiNW ARC does not exceed 10%. This low efficiency is attributed to many factors. One of the most important is the surface recombination velocity which strongly increases when using SiNW ARC, due to the large surface area [16, 17]. It is necessary, therefore, to passivate the SiNW surface, minimizing the surface states [18].

When subgroup analyses by pathological types were considered,

CYPIAl Mspl and exon7 variant alleles were found to be associated with a 1.4-1.9 fold increase in the risk of lung SCC. For lung AC, only CYPIAl Mspl gene polymorphism was significant, however, ABT263 for lung SCLC, no significant association was found for two genotypes. Our findings were consistent with the Le Marchand L et al study [32] with largest sample sizes of case and control. Le Marchand et al. [32] hypothesized that genetic susceptibility to PAHs predominantly JPH203 concentration caused lung SCC and nitrosamines caused lung AC. With introduction of filter-tipped cigarettes, probably decreased smokers’ exposure to PAHs and increased their exposure to nitrosamines, decreasing trend of SCC, relative to the increase in AC indirectly supports this hypothesis [83]. Different carcinogenic processes may be involved in the genesis of various tumor types because of the presence of functionally different CYP1Al Mspl and exon7 gene polymorphisms. However, the possible molecular mechanisms to explain these histology-specific differences in the risk of lung cancer remain unresolved. Recent epidemiological and biochemical studies have suggested increased susceptibility

to tobacco carcinogens in women compared to men [84–86]. Moreover, CYP1A1 mRNA expression in the lung has been observed to be more than two-fold higher in female smokers compared with male smokers [87]. Cytidine deaminase Another possibly was due to the effect of circulation estrogens, which have Selleckchem Volasertib been shown to induce expression of PAH-metabolizing enzymes, such as CYP1A1, thereby increasing metabolic activation

of carcinogens [88]. In premenopausal women, a higher expression of estrogen can be expected. Estrogen by itself can be involved in carcinogenesis and additionally, it can stimulate expression of CYPs in the female. In our meta-analysis, we found that the effect of CYP1A1 exon7 genotype was observed only in Females, however, for CYP1A1 Mspl the effect was only observed among Males. Our results, along with the previous studies involved above, suggest the difference roles on the two polymorphisms of CYP1A1 genotypes in the susceptibility of lung cancer between Females and Males. As we know, aside from genetic factor, smoking is the major risk factor of lung cancer. Most studies out of 64 studies reported information on smoking habits of cases and controls, however only sixteen eligible publications provided non-smokers information. Our meta-analysis results showed that a significantly increased risk was found to be associated with the CYP1A1 MspI and exon 7 gene polymorphisms and lung cancer risk in smokers, however, no significant association was found among non-smokers neither CYP1A1 MspI or exon 7 genotype. Tobacco smoke contains many of carcinogens and procarcinogens, such as benzopyrene and nitrosamine.

Although the genome sequence of B. microti is almost identical to that of B. suis with an overall sequence identity of 99.84% in aligned regions, phenotypically these species differ significantly which might be caused by variable gene regulations and different growth patterns [43]. Both respirometry and tetrazolium reduction assays proved that B. abortus Lazertinib solubility dmso is characteristically stimulated by L-alanine, L-asparagine and L-glutamate [30]. In contrast, the Micronaut™ results were heterogeneous for L-alanine in B. abortus strains. The differences in

metabolic activity observed between these methods might be caused by the cut-off selected in our experiments. Deduced from the OD values measured with the Micronaut™ system three levels of substrate utilization could be defined: no/weak metabolic activity (-), moderate metabolic activity (+), and strong metabolic activity (++) [Additional file 7]. The different levels of oxidative metabolic activity on amino acid and carbohydrate substrates determined by Micronaut™ agreed with the oxygen uptake levels for most substrates measured

by conventional manometric techniques [25]. However, owing to the dispersion of the individual OD values, quantitative differences are of limited practical relevance. The selection of cut-offs which delineated positive and negative metabolic Foretinib mouse activity greatly contributed to the clarification of the presentation of substrate utilization. Of course, the

limit between two activity patterns is rather artificial. Conclusions The results of the comprehensive biotyping study presented evidence that species of the genus Brucella can Amobarbital be correctly identified by their metabolic patterns. Although a range of metabolic properties allows clustering of Brucella into species and biovars clearly defined boundaries do not always exist. Based on a selection of 93 different substrates out of 570 DNA Damage inhibitor initially tested, a Brucella specific 96-well Micronaut™ microtiter plate was developed and successfully evaluated in a large panel of Brucella strains comprising all currently known species and biovars. Although the Micronaut™ system still requires a biological safety cabinet throughout the procedure it is much easier to handle and does not require the preparation of specific reagents leading to quicker results than conventional microbiological methods. Hence, the Micronaut™ system may replace or at least complement time-consuming tube testing. Furthermore, an easy to handle identification software facilitates its applicability for routine use. The newly developed Brucella specific 96-well Micronaut™ plate fulfilled the performance criteria recommended for a typing assay, i.e. typeability, reproducibility, stability and discriminatory power.

The difference

for Ag and Au can be understood from the forces acting on the dopant atom. At the key relax step where the dopant atom falls to the surface, we decompose Epoxomicin price the forces acting on Ag and Au atoms into the X and Z directions at every calculation step. The results are shown in Figure 8. For the Ag dopant, the MK-2206 price component forces have negative peak values and the one in the Z direction is greater than that in the X direction, which means that the vertical attraction is greater than the lateral one when the dopant atom is falling. Finally, the Ag atom falls into the step site (see Figure 7c). For the Au dopant, however, the component force in the X direction has a greater peak value than that in the Z direction. It means that the Au dopant tends to drop onto the step terrace (see Figure 7f). Though withdrawing the tip vertically in the Z direction to position the dopant is effective for the Ag atom, it lacks general applicability. Also, the position details and

component forces reveal that it is not reliable even in small thermal disturbance (see Figures 7 and 8). Figure 7 Withdrawing the tip vertically in Z direction to position the dopant. (a – c) The positioning process of the Ag atom. (d – f) The undesirable release of the Au atom. Figure 8 The forces acting on Ag (a) and Au (b) dopant atom in every calculation step The forces acting on Ag (a) and Au (b) dopant atom in every calculation step. The red curve is the component force in the Z direction. The black curve denotes the component force in the X direction. Conclusion Based on first-principles Pritelivir molecular weight simulation, we theoretically investigate the substitutional single-atom doping on stepped Al (111) surface via atomic manipulation. An effective method is proposed in which a trimer-apex tip is adopted to extract the surface atom and then a single-apex one is used to position the single dopant atom. In the positioning process, the tip moves first in the vertical direction and then in a lateral one. Rebamipide Both Ag and Au dopants are successfully positioned to the specific site in atomic precision, which indicates that the method owns a potential of general application.

The corresponding energy curves show that both extraction and doping processes have a high reliability against thermal disturbances. Additionally, the manipulation processes are insensitive to the tip orientation, which is beneficial to the realization of such doping approach in practice. Acknowledgments This work is supported by the National Basic Research Program of China (973 Program) under Grant No. 2012CB934200 and Chinese NSF under Grant No. 11074042 and No. 51071048. References 1. Eigler DM, Schweizer EK: Positioning single atoms with a scanning tunnelling microscope. Nature 1990, 344:524.CrossRef 2. Meyer G, Bartels L, Zöphel S, Henze E, Rieder KH: Controlled atom by atom restructuring of a metal surface with the scanning tunneling microscope.

3) 7 (20.6) 4 (23.5) 0

(0) 6 42 (13.4) 5 (14.7) 0 (0) 0 (0) 7 36 (11.5) 2 (5.9) 0 (0) 0 (0) 8 23 (7.3) 4 (11.8) 0 (0) 0 (0) 9 12 (3.8) 1 (2.9) 0 (0) 0 (0) 10 9 (2.9) 3 (8.8) 0 (0) 0 (0) 11 1 (0.3) 0 (0) 0 (0) 0 (0) In parenthesis the percentage of the total number of woody or endemic species a Calliandra Cyclosporin A concentration trinervia has been reported for Tumbes (Peru) and is very likely found also in adjacent Selleck AZD1480 El Oro (Ecuador), but no voucher is mentioned (Barneby 1998), same situation applies for Eriotheca discolor, found mainly in Tumbes and Piura (and reported also in another three departments in Peru), but no voucher reported for adjacent provinces in Ecuador (R. Linares-Palomino, unpub. data) The altitudinal distribution of absolute species richness in the Equatorial Omipalisib datasheet Pacific region showed more or less a constant pattern with similar values in the altitudinal bands below 1,000 m.a.s.l. (Fig. 2a; Appendix 2). In the montane altitudinal band, however, species richness decreased by about 50 species. Species richness in Ecuador peaked in the hills and decreased slightly towards the coastal lowlands and substantially towards

higher altitudes. In Peru, species richness increased from the coastal lowlands towards the sub-montane region and decreased in the montane region. The endemic species in Ecuador and Peru showed a similar pattern to overall woody species richness in each country (Fig. 2b; Appendix 2). Species endemic to the Equatorial Pacific region, however, increased from the lowlands to the sub-mountains, and decreased substantially in the montane region. Values of woody species density (Fig. 2c; Appendix 2) and endemic species density (Fig. 2d; Appendix 2) per 1,000 km2 of each altitudinal band, showed that there were substantially more species and endemics per unit area in the montane region than at any other altitude in Ecuador, Peru or the Equatorial Pacific region. The lowest total species and endemics density values were in the lowlands of Ecuador, Peru and the Equatorial Pacific region. Fig. 2 Altitudinal distribution of absolute woody (a) and endemic species richness (b).

enough Number of woody (c) and endemic species (d) per 1,000 km2. Note the different y-axis scales. Solid line Pacific Equatorial region, dotted line Ecuador, dashed line Peru Total area of the geopolitical units had no effect on total vascular plant species numbers, or on woody SDF species and endemics (Pearson correlation values of 0.16, −0.20 and 0.37, respectively, all non-significant, n = 11). The total area between sea level and 1,100 m.a.s.l. had no effect on woody SDF species and endemics (Pearson correlation values of −0.13 and 0.0, respectively, all non-significant, n = 11). The analysis of species distribution by geopolitical unit showed that half of all species (51.4%) have been reported in four or less provinces or departments (13.1% in only one) (Table 2). Endemic species restricted to either Ecuador or Peru showed an extremely local distribution, 41.2 and 56.

Table 2 Primer sets used for the 16S rRNA gene quantification of A. muciniphila , F. prausnitzii , Enterobacteriaceae , Clostridium cluster IV, Bifidobacterium and Lactobacillus group by qPCR. Amplicon size, annealing and

fluorescence acquisition temperature are also reported Target microorganism Primer set Sequence (5′ to 3′) Product size (bp) Annealing temp (°C) Fluorescence acquisition temp (°C) Reference Akkermansia muciniphila AM1 CAGCACGTGAAGGTGGGGAC 349 63 88 [31]   AM2 CCTTGCGGTTGGCTTCAGAT         Faecalibacterium prausnitzii Fprau223F GATGGCCTCGCGTCCGATTAG 199 67 85 [32]   Fprau420R CCGAAGACCTTCTTCCTCC see more         Enterobacteriaceae Eco1457F CATTGACGTTACCCGCAGAAGAAG 195 63 87 [32]   Eco1652R CTCTACGAGACTCAAGCTTGC         Clostridium

Cl_IV S-*-Clos-0561-a-S-17 TTACTGGGTGTAAAGGG 588 60 85 [33]   S-*-Clept-1129.a-A-17 TAGAGTGCTCTTGCGTA         Bifidobacterium bif-164 GGGTGGTAATGCCGGATG 523 60 90 [34]   bif-662 CCACCGTTACACCGGGAA         Lactobacillus group Lac1 AGCAGTAGGGAATCTTCCA 327 61 85 [35]   Lac2 ATTYCACCGCTACACATG         Results Faecal microbiota profile of atopic children and healthy controls The faecal microbiota of 19 atopic children and 12 healthy controls living in Italy was characterized by means of the HTF-Microbi.Array platform (Additional files 4 and 5) [24]. Hybridization experiments were performed in two replicates. Pearson’s correlation AZD8931 research buy coefficients ranging from 0.95 and 0.99 were achieved between the two replicates, proving the high reproducibility of the phylogenetic profiles obtained by the HTF-Microbi.Array platform. A PCA of the fluorescence signals from atopics and controls was carried out.

The diagnosis of atopy was considered as a dummy environmental variable. As shown in Figure 1A, the principal components PI-1840 PC2 and PC3, which collectively represented only a minor fraction of the total variance (9.7%), resulted in the separation of selleck compound samples according to the health status. In order to identify the bacterial lineages showing differences in abundance between atopics and controls, probe fluorescence signals obtained from the HTF-Microbi.Array in atopics and controls were compared by box plot analysis (Additional file 6). Probes showing P < 0.3 are represented in Figure 1B. Atopic children showed a tendency towards reduction of A. muciniphila F. prausnitzii et rel. and Ruminococcus bromii et rel. (Clostridium cluster IV), and Clostridium cluster XIVa, and were enriched in Enterobacteriaceae Bacillus clausii and Veillonella parvula. Figure 1 Analysis of the HTF-Microbi.Array fluorescence signals. A: PCA of the HTF-Microbi.Array fluorescence signals. Atopy or health status were considered as dummy environmental variables (green triangles) and indicated as atopic and control, respectively.

J Appl Phys 2011, 109:044311.CrossRef 6. Bradley RM, Harper JME: Theory of ripple topography induced by ion bombardment. J Vac Sci Technol A 1988, 6:2390–2395.CrossRef 7. Makeev MA, Cuerno R, Barabási A-L: Morphology of ion-sputtered surfaces. Nucl

Instrum Methods Phys Res B 2002, 197:185–227.CrossRef 8. Muñoz-García J, Castro M, Cuerno PLX3397 solubility dmso R: Nonlinear ripple dynamics on amorphous surfaces patterned by ion beam sputtering. Phys Rev Lett 2006, 96:86101.CrossRef 9. Madi CS, Davidovitch B, George HB, Norris SA, Brenner MP, Aziz MJ: Multiple bifurcation types and the linear dynamics of ion sputtered surfaces. Phys Rev Lett 2008, 101:246102.CrossRef 10. Madi CS, George HB, Aziz MJ: Linear stability and instability patterns in ion-sputtered silicon. J Phys Condens Matter

2009, 21:224010.CrossRef 11. Madi CS, Anzenberg E, Ludwig KF Jr, Aziz MJ: Mass redistribution causes the structural richness of ion-irradiated surfaces. Phys Rev Lett 2011, 106:066101.CrossRef 12. Norris SA, Samela J, Bukonte L, Backman M, Djurabekova F, Nordlund K, Madi CS, Brenner MP, Aziz MJ: Molecular dynamics of single-particle impacts predicts phase diagrams for large scale pattern formation. Nat Commun 2011, 2:276.CrossRef 13. Castro M, Cuerno R: Hydrodynamic approach to surface pattern formation click here by ion beams. Appl Surf Sci 2012, 258:4171–4178.CrossRef 14. Castro M, Gago R, Vázquez L, Muñoz-García J, Cuerno R: Stress-induced solid flow drives surface nanopatterning of silicon by ion-beam irradiation. Phys Rev B 2012, 86:214107.CrossRef 15. Muñoz-García J, Gago R, Cuerno R, Sánchez-García J, Redondo-Cubero A, Castro M, Vázquez L: Independence of interrupted coarsening on initial system order: ion-beam nanopatterning of amorphous versus crystalline silicon targets. J Phys Condens Matter 2012, 24:375302.CrossRef 16. Kumar T, Kumar A,

Lalla N, Hooda S, Ojha S, Verma S, Kanjilal RG7420 in vitro D: Role of ion beam induced solid flow in surface patterning of Si (100) using Ar ion beam irradiation. Appl Surf Sci 2013. 17. Nishimori H, Ouchi N: Formation of ripple patterns and dunes by wind-blown sand. Phys Rev Lett 1993, 71:197–200.CrossRef 18. Miao T-D, Mu Q-S, Wu S-Z: Computer simulation of aeolian sand ripples and dunes. Phys Lett A 2001, 288:16–22.CrossRef Competing interests The authors declare that they have no competing interests. Authors’ I BET 762 contributions TK designed and performed the experiments, and analyzed the results. AK helped in the analysis of results as well as in writing the manuscript. DC helped during the irradiation of samples and in XTEM analysis. NP performed the XTEM measurement. DK participated and contributed in the design of study and coordination. All authors read and approved the final manuscript.”
“Background Graphene has been a subject of intense research since it was discovered in 2004 because of its intriguing band Structure [1, 2].