Antibodies reactive with desmogleins 1 and 3 are considered to be highly specific serological markers for Selleck Nutlin 3a diagnosis. In the individual patient, antibody levels correlate with disease activity, showing a remarkable increase

during exacerbations and a drop during remissions [33]. An important clue to the pathogenicity of desmoglein 3 antibodies was provided by the study of Anhalt et al. [1], wherein the passive transfer of IgG from patients with PV to newborn mice resulted in the development of suprabasilar acantholysis and intercellular deposition of IgG and C3, as demonstrated by immunofluorescence. In more recent studies, even monovalent Fab immunoglobulin fragments were found to be pathogenic in GSK2126458 these mice [34,35]. Another study using the same experimental model showed that the blister formation was abolished when anti-desmoglein 3 IgG from the sera of patients was immunoadsorbed with recombinant desmoglein 3 [2]. It is important to emphasize that in PV it is the antibodies that cause the tissue injury, in the absence of any inflammatory mediators [1,36,37].

The exact pathogenetic mechanism underlying the blister formation is still not understood completely. A direct inhibitory effect of the antibodies on the cell-to-cell adhesion function of the desmogleins was supported by a remarkable experiment by Koch et al. [38], wherein the genetic deletion of desmoglein 3 in mice led to the development of suprabasilar blisters in the oral mucosa and skin, very similar to the phenotype of patients with PV. In another study, anti-desmoglein-3 antibodies appeared to interfere directly with desmoglein function within the desmosome, causing split desmosomes, without keratin retraction, in areas of acantholysis [39]. The anti-desmoglein antibodies might deplete the desmosomes of desmoglein directly or, alternatively, deplete the cell surface of desmoglein before it becomes incorporated into the desmosome, thereby decreasing the precursor pool [40–43].

In either case, it may be concluded that PV antibodies target desmoglein 3 for endocytosis and see more lysosomal degradation: adhesion on the cell surface is necessary to prevent the endocytosis of organizing desmosomes [44]. Various studies have suggested a role for signalling pathways, associated with either acantholysis or causal. For example, adding PV-IgG to keratinocytes caused phosphorylation of desmoglein 1, leading to its dissociation from plakoglobin [45], a part of some signalling pathways. Plakoglobin was found to be a necessary ingredient for PV-IgG to cause retraction of keratin filaments in culture, serving possibly as a marker of early acantholysis [46]. A study of PV-IgG-treatment-induced phosphorylation of heat shock protein 27 in cells implicated the p38 mitogen-activated protein kinase (MAPK) signalling pathway by showing that inhibiting their pathway prevented cytoskeletal reorganization, associated presumably with loss of cell adhesion [47].

) and the possibility of reverse causation.[106] On the other hand, both generation and DDAH-mediated metabolism of ADMA as well as

inhibition of NOs activity by ADMA are intracellular processes. Most studies report on plasma ADMA levels, based on the underlying assumption that these levels accurately reflect intracellular ADMA levels. It is tempting to speculate that there may be (patho) physiological conditions in which intracellular and circulatory ADMA are inversely associated. A situation like this may occur if CAT expression or activity is diminished, resulting in a slow cellular egress of ADMA, thereby increasing intracellular, but decreasing extracellular ADMA levels.[108, 109] Still lowering plasma ADMA concentrations may represent a novel therapeutic target for prevention of progressive renal damage. Angiotensin converting enzyme inhibitors Selleck AP24534 (ACEIs), angiotensin AT1 receptor blockers (ARBs) have been shown to decrease plasma ADMA in many studies.[96, 110-112] Agents affecting ADMA more specifically (e.g. PRMTs inhibitors or DDAH inducers) await investigation. Non-pharmacological therapy, such as DDAH gene transfer, may be the future.[68, 113] Also it is possible to identify the genetic polymorphisms of DDAH-1 that are correlated with reduced transcriptional activity in vitro and reductions of DDAH-1 m-RNA levels in vivo that have as a result increased ADMA levels.[69] This might

lead us to a certain population of patients with CKD stage 1 with or without AZD5363 research buy arterial hypertension or diabetes mellitus that are in greater risk Terminal deoxynucleotidyl transferase for renal deterioration. “
“Heparin, a highly sulfated glycosaminoglycan,

has been shown to have a renoprotective effect on renal diseases, but its mechanisms remain to be elucidated. In this study, we examined the effect of heparin on podocytes by using primary cultured podocytes positive for podocyte-specific markers including podocin and podocalyxin. Podocytes were cultured from highly purified glomeruli isolated by the method with renal perfusion with magnetic beads and digestion of collagenase. Podocyte-specific gene expressions and proteins were examined by real-time polymerase chain reaction (PCR), Western blotting and immunofluorescence microscopy. Real-time PCR showed that addition of heparin to the culture media significantly upregulated most of the podocyte-specific genes in a dose-dependent and time-dependent manner. Western blotting showed a marked increase in protein levels of nephrin and podocin. Podocin localization at cell–cell contact sites became conspicuous in the presence of heparin. The effect of heparin was observed even in culture media deprived of bovine foetal serum. Heparan sulfate, less sulfated than heparin, and hyaluronan did not show such effects, but sulfated dextran did markedly. Heparin acts on cultured podocytes to increase podocyte-specific gene expressions. A high degree of sulfation is crucial for the effect of heparin.

After sharing a particular type of referent with an adult in an excited manner, 18-month-olds subsequently found a picture of that type of referent more worthy of see more declarative pointing than some other picture—but only for that adult, not for a different

adult. Mixed results were found with 14-month-olds. We thus show that by 18 months, infants accurately track their shared experiences with specific individuals and use this to make communicative decisions. These results also demonstrate that infants sometimes use declarative pointing to indicate not totally “new” things, as in the classic formulation, but things which are “old” in the sense that “we” should recognize them as similar to something we have previously shared. “
“Collaborative activities in which individuals coordinate their actions to attain a common goal play a fundamental role in our everyday lives. Evidence suggests that infants engage in collaborative activities before their first birthday; however,

little is known about infants’ understanding of collaborative action. Using a visual habituation paradigm, this research consists of two experiments designed to investigate whether 10-month-olds understand that the actions of collaborative partners are critical to the attainment of a common goal. The results of Experiment 1 suggest that 10-month-olds represent the actions of collaborating Selleck GS-1101 partners in terms of a common collaborative goal only after receiving active experience with a collaborative activity. Experiment 2 demonstrated that infants who received

active experience with a collaborative activity viewed active engagement in a collaboration as being critical for an individual’s actions to be interpreted as being directed towards a collaborative goal. Together, these findings demonstrate that 10-month-olds exhibit an understanding of the shared nature of collaborative goals after a highly salient experience with the activity. Identifying the effects of experience on infants’ understanding of collaborative goals in a laboratory context provides insights into the role that experiences in their everyday lives might play in their understanding of collaboration. “
“We investigated whether Tyrosine-protein kinase BLK maternal mind-mindedness in infant–mother interaction related to aspects of obstetric history and infant temperament. Study 1, conducted with a socially diverse sample of 206 eight-month-old infants and their mothers, focused on links between maternal mind-mindedness and (i) planned conception, (ii) perception of pregnancy, and (iii) recollections of first contact with the child. The two indices of mind-mindedness (appropriate and nonattuned mind-related comments) related to different aspects of obstetric history, but no strong associations were seen with socioeconomic status, maternal depression, or perceived social support.

In order to evaluate these two vector candidates, we further engineered these otherwise isogenic strains to express an identical Influenza A heterologous antigen from a chromosomally located gene fusion. The intent of the study was to evaluate the safety of the vectors by the oral route, and determine in a translational study whether human immune responses to a vectored viral antigen could be detected.

Influenza A nucleoprotein (NP) was chosen as a model viral antigen, as it has been evaluated previously selleck inhibitor as a conserved, and potentially cross-protective, vaccine antigen for influenza (11–13). Influenza A NP has been successfully expressed in L. monocytogenes (2, 14) and, as a component of both live and killed influenza vaccines given to millions, is likely safe to administer to volunteers. An Influenza A NP gene segment was chosen to include known human T cell epitopes (15, 16). Additionally, a well-studied nine-amino-acid epitope of the Influenza A M1 matrix protein recognized by HLA-A2 humans was included, GILGFVFTL (17), as HLA-A2 is a frequent haplotype

PD-0332991 in vivo in our North American Caucasian volunteer population. We report here the preclinical and clinical evaluation of the two vector strains BMB72 (ΔactA/plcB-NP) and BMB54 (ΔactA/inlB-NP). This Phase 1 clinical study was performed to further evaluate and compare two listerial vectors, and is not intended as a step towards commercialization of these vaccine strains or generation of an oral influenza vaccine. All the L. monocytogenes strains used in this study are derived from the streptomycin-resistant L. monocytogenes strain 10403S (18). Table 1 contains a list of the bacterial strains used to engineer the recombinant strains and their origins. The Influenza A gene fusions were constructed by generating a synthetic polynucleotide coding for the GILGFVFTL epitope of the influenza A M1 protein that was ligated to DNA encoding a 297-amino-acid portion of the Influenza A NP and cloned into the pEJ140PhoA vector (a gift from Jeff F. Miller at the University of California, Los Angeles, CA, USA). The Influenza A nucleoprotein segment was constructed by PCR amplification from a L. monocytogenes

Mirabegron strain (DPL1659; a gift from Daniel Portnoy at the University of California, Berkeley, CA, USA) that expresses amino acids 1–480 of the Influenza A nucleoprotein (Influenza A/PR/8/34) using primers (5′-to-3′) TTGGATCCCCAGGGTTCGACTCCT and GGGCGCGCCGGAGGCCCTCTGTTG. The modified pEJ140PhoA plasmid was then digested with NotI and the fragment containing the Influenza A NP fusion protein was ligated into the NotI site of a modified pPL2 site-specific integration vector (19). The resulting plasmid was then transformed into Escherichia coli SM10 (20) and subsequently mated into, and then plasmid sequences cured from, the attenuated background L. monocytogenes strains. Three nested segments of nucleoprotein of increasing size were evaluated for expression.

burgdorferi (Fikrig et al., 1991). Therefore, a major emphasis in B. burgdorferi research has been Alvelestat research buy to develop a new vaccine that could be used as a safe and effective second-generation preventative against Lyme disease. As B. burgdorferi is an extracellular pathogen, and humoral immunity has been shown to be protective

against this organism, vaccine studies have revolved around identifying borrelial antigens that are (1) surface exposed, (2) conserved among different strains and genospecies of Borrelia spirochetes, and (3) produced during tick transmission and mammalian infection. Any outer surface protein that fulfills these three basic requirements is considered an excellent candidate for vaccine studies. As the surface of B. burgdorferi is the interface between the host and pathogen during infection, outer membrane proteins (OMPs) also have been implicated as important virulence factors. As a first step in identifying borrelial proteins that are surface exposed, many laboratories performed microarray analyses

to examine the global response of gene expression in B. burgdorferi after exposure to either temperature shift or cultivation within a mammalian host environment (Revel et al., 2002; Brooks et al., 2003; Ojaimi et al., 2003; Tokarz et al., 2004). The underlying assumption in these studies, which has been supported by empirical data, is that genes upregulated by temperature will correspond to genes upregulated during tick feeding and transmission to the mammalian host, while genes upregulated during cultivation PF-02341066 manufacturer Osimertinib concentration in a mammalian host correspond to genes upregulated during mammalian infection. Using these two different environmental stimuli, numerous

genes that are upregulated during tick feeding and/or mammalian infection were identified. Among the genes observed to be upregulated by temperature- and/or mammalian-specific signals, over 50 have been shown to encode known or putative leader peptides, indicating that they may encode outer surface proteins (Revel et al., 2002; Brooks et al., 2003; Ojaimi et al., 2003; Tokarz et al., 2004). Further, many of the genes identified were observed to encode hypothetical OMPs that had not previously been characterized. Therefore, a major goal in the Lyme disease field in recent years has been to further characterize surface-exposed proteins by (1) determining their cellular location throughout the enzootic cycle of B. burgdorferi, (2) examining their overall conservation among different strains and genospecies of B. burgdorferi, and (3) assessing their ability to protect mice and nonhuman primates from experimental Lyme disease. The combined studies have led to the identification of several candidate vaccine molecules and to the identification of many virulence determinants. The enzootic life cycle of B. burgdorferi is complex and typically involves horizontal transmission between ticks of the genus Ixodes and wild rodents (Lane et al., 1991).

Cells were washed twice with degassed sample buffer and resuspended in 90 μl of the sample buffer. The cell suspension was then incubated with 10 μl MACS anti-rat IgG MicroBeads (Miltenyi Biotech) at 4° for 15 min. The cell–bead suspension was washed by centrifugation and the cell–bead complex was Crizotinib datasheet resuspended in 500 μl degassed sample buffer. The sample was then applied to a MACS MS+ selection column (Miltenyi Biotech) in the presence of the MiniMACS high-energy permanent magnet (Miltenyi Biotech).

The negative (non-GP2 binding) cells were allowed to flow through the column. The column was washed five times with degassed sample buffer and the fractions were pooled with CAL 101 the negative cells. The magnet was then removed and the positive (GP2 binding) cells were flushed out of the column. Both positive and negative samples were assessed for viability and enrichment using the Countess® Automated Cell Counter (Invitrogen). Cells were then resuspended in Lysis/Binding Buffer and the gene expression of Gp2 and Egr1 was assessed

by qRT-PCR (see Supplementary material, Table S1 for primer sequences). Frozen intestinal sections were cut into 10-μm thick sections, which were fixed with 10% neutral buffered formalin (Sigma) and then permeabilized with 0·2% Triton-X-100 (Sigma). The plant lectin Ulex europaeus agglutinin 1 (UEA-1) was used to stain M cells. UEA-1-FITC (Vector Laboratories Ltd, Peterborough, UK) was added to cells at a concentration of 10 μg/ml. Cells were then counterstained with 0·165 μm DAPI (Molecular Probes). Cells were mounted with ProLong® Gold anti-fade reagent using No. 1·5 coverslips. Slides were viewed with an Olympus FV1000 confocal laser scanning microscope (Olympus, Hamburg, Germany). THP-1 monocytes

(monocytic leukaemia cell line; ATCC, TIB 202) maintained in RPMI-1640 (Gibco) supplemented with 10% FBS, 100 μg/ml penicillin, 100 U/ml streptomycin and 0·05 mm 2-mercaptoethanol (Gibco) were seeded in six-well tissue culture dishes (Sarstedt, Nümbrecht, Ixazomib in vitro Germany) at a concentration of 1 × 106 cells/ml. Bacteria were cultured overnight, washed twice by centrifugation (3200 g for 10 min), and resuspended in PBS at a final concentration of 1 × 109 colony-forming units/ml. Bacteria (1 ml) were labelled with 10 μm carboxyfluorescein diacetate succinimidyl ester (CFSE, CellTrace™ Cell Proliferation Kit; Molecular Probes) for 15 min. Bacteria were then biotinylated using No-Weigh™N-hydroxysulphosuccinimide (Sulfo-NHS)-Biotin (Pierce, Thermo Scientific, Rockford, IL) according to the manufacturer’s instructions. The CFSE-labelled-biotinylated bacteria were added to the THP-1 cells at a multiplicity of infection of 10 : 1 and THP-1 cells and bacteria were co-incubated for 16 hr at 37° with 5% CO2.

This controls for the effect of diluting the level of antibodies when adding DTT to the reaction. Hence, if the crossmatch becomes negative with the addition of phosphate-buffered saline, the results with DTT cannot be fully interpreted as the result may have become negative by diluting the antibody level. Complement-dependent cytotoxicity crossmatching was

pioneered by Terasaki and colleagues in the 1960s.3,8 It seeks to identify clinically significant donor specific HLA antibody mediated responses for a given recipient. Lymphocytes from the donor are isolated and separated into T and B cells. Serum from the recipient is mixed with the lymphocytes in a multi-well plate. Complement is then added (usually derived from rabbit serum). If donor-specific antibody is present and binds to donor cells, the complement cascade will be activated via the classical high throughput screening pathway resulting

in lysis of the lymphocytes (see Fig. 1). The read-out of the test is the percentage of dead cells relative to live cells as determined by microscopy. The result can thus be scored on the percentage of dead cells, with 0 correlating to no dead cells; scores of 2, 4 and 6 represent increasing levels of lysis. On this basis, a score of 2 is positive at a low level, consistent with approximately 20% lysis (generally taken as the cut-off for a positive result). A score of 8 represents all cells having lysed and

indicates the strongest possible reaction. The PR-171 purchase use of a scoring system allows a semi-quantitative analysis of the strength of reaction. Another way to determine the strength of the reaction is to repeat the crossmatch using serial doubling dilutions of the recipient serum (often known as a ‘titred crossmatch’). In this way, dilutions are usually performed to 1 in 2, 4, 8, 16, 32, 64 and so on. In the situation of a high titre of high avidity DSAb it may be that many dilutions are required for the test to become negative (e.g. 1 in 128). With antibody at a low level or one with a low affinity, a single dilution may be enough to render the crossmatch result negative. This may also give an indication as to the likelihood that a negative crossmatch could be achieved PtdIns(3,4)P2 with a desensitization protocol. The basic CDC crossmatch can be enhanced by the addition of antihuman globulin (AHG). This technique increases the sensitivity of the CDC crossmatch as a result of multiple AHG molecules binding to each DSAb attached to the donor cells thereby amplifying the total number of Fc receptors available for interaction with complement component 1, which increases the likelihood of complement activation and cell lysis. In Australia this assay is not routinely used. It is also possible to have a negative crossmatch in the presence of a DSAb.

Other investigations have reported several Gr-1+ mononuclear cells affecting immune responses (Bronte et al., 2000; Nakano et al., 2001; Delano et al., 2007). Bronte et al. (2000) found Gr-1+CD11b+CD31+ macrophages in the secondary lymphoid organs of immunocompromised mice that suppress the function of CD8+ T cells (designated as inhibitory macrophages). Nakano et al. (2001) reported Gr-1+CD11b−CD11c+ cells found in mouse lymph node and spleen that display characteristics of plasmacytoid

dendritic cells and produce interferon-α (IFN-α) Pictilisib in vitro after stimulation with the influenza virus. Delano et al. (2007) have recently demonstrated the dramatic increase of Gr-1+CD11b+ cells with heterogenous morphologies in the spleen, lymph nodes and bone marrow during polymicrobial sepsis, which produce inflammatory cytokines and chemokines including TNF-α, and contribute to the suppression of antigen-specific CD8+ T cell IFN-γ production and a shift from Th1- to Th2-type antibody responses. At present, the relationship between these reported cells and Gr-1dull+ cells described in the current study remains unclear. Although both Gr-1dull+ cells and neutrophils showed intracellular expression of TNF-α in a flow cytometric analysis, it is not clear as to which cell populations contributed more to the production of this cytokine in the lungs during infection with S. pneumoniae.

In this respect, the sorted Gr-1bright+ cells (neutrophils) selleckchem did not or marginally secreted TNF-α second in an in vitro culture. However, these findings may not necessarily exclude their possible contribution to the in vivo synthesis of this cytokine. In our hands, in vivo depletion of Gr-1+ cells by the specific mAb did not lead to the complete inhibition of TNF-α synthesis detected in BALF, which suggested that TNF-α production was not completely ascribed to neutrophils and Gr-1dull+ cells. We also observed the expression of this cytokine in F4/80+ cells at an earlier stage of pneumococcal infection before Gr-1dull+ cells appeared. Considered collectively, these results suggested that alveolar

macrophages may contribute in part to the synthesis of TNF-α in lungs. In conclusion, we revealed the possible involvement of neutrophils and Gr-1dull+ CD11c+ macrophage-like cells in the production of TNF-α in lungs at an early stage of infection with S. pneumoniae. TNF-α was shown to play pivotal roles in recruiting neutrophils and protecting mice from this bacterial pathogen, suggesting that this unusual subset may contribute to the host defense by inducing this cytokine. Thus, the present study provides important implications for our understanding of the pathogenic mechanism of pneumococcal infection and development of more effective vaccine strategies. Further investigations will be necessary to define the more detailed characteristics of this population and its precise role in the host-protective responses.

For example, ligation of TLR4 with LPS in first-trimester trophoblasts produces a slow inflammatory response, characterized by a modest

up-regulation of cytokines.39 In contrast, PDG, which signals through Akt inhibitor TLR2, induces apoptosis in trophoblasts rather than stimulating a cytokine response.39 The pattern of response following TLR ligation also depends on the type of stimuli. While LPS did not induce apoptosis in first-trimester trophobalsts,39Chlamydia heat shock protein 60 was shown to induce apoptosis in trophoblasts through TLR4.46 This differential effect of different TLR4 ligands may be explained by the diverse downstream signaling events and differential use of adapter molecules by different TLR4 ligands. This differential response of the same receptor

ligation was also observed in TLR2. Induction of apoptosis through TLR2 ligation was demonstrated in first-trimester trophoblasts not only by PDG39 but also by ultraviolet-inactivated human cytomegalovirus (HCMV).47 On the other hand, using third-trimester trophoblasts, Mitsunari et al.37 reported that macrophage-activating lipopeptide-2 (MALP-2) AZD2014 purified from Mycoplasma fementans, signaled TLR2 and induced the expression of cyclooxygenase (COX)-2 and prostaglandin E2. This differential effect between first- and third-trimester trophoblasts may be attributable to the presence of TLR6 in third-trimester trophoblast. As we described, the response following TLR2 stimulation appears to be dependent upon the cooperative receptors, TLR1 and TLR6. Indeed, our in vitro studies suggest that the pro-apoptotic effect observed following PDG treatment is mediated by TLR1 and TLR2 heterodimers, which then activate caspase-8, -9 and -3 through MyD88/FADD pathway, whereas the presence of TLR-6 may shift the type of response; cell death CYTH4 is prevented and a cytokine response ensues through NFκB activation.48 We have also shown that

TLR4 ligation by LPS inhibited the migration of trophoblast cells.49 This effect may explain the incomplete invasion of the trophoblast to the spiral arteries in the uterus observed in patients with pre-eclampsia. The placenta may become exposed not only to bacteria but also to virus, which may pose a substantial threat to the fetus. The trophoblast has unique characteristics for responding to viral infections. TLR3, a receptor known to mediate immune responses toward viral dsRNA,21 is expressed by first-trimester trophoblasts.38 As a result of poly(I:C) (a synthetic dsRNA) stimulation, trophoblasts secrete pro-inflammatory cytokines as well as anti-microbial products. Using first-trimester trophoblast, we described the production of interferon-β (IFN-β) following poly(I:C) treatment.

Assay was performed as described [17]. Assay was performed as described [39] with some modifications. Anti-Syk immunoprecipitates from pervanadate stimulated RBL-2H3 cells,

used as source of active enzyme, and anti-Hrs immunoprecipitates from unstimulated RBL cells, used as substrate, were washed five times with lysis buffer, once with the kinase buffer (30 mM Hepes, pH 7.4, 5 mM MgCl2, 5 mM MnCl2, and 100 μM Na3VO4), mixed, and resuspended in 40 μL kinase buffer containing 10 μCi of (γ-32P) ATP and 1 μM cold ATP. After 10 min of incubation at 30°C, beads were washed three times with lysis buffer, eluted with SDS-sample buffer and analyzed by SDS-PAGE and autoradiography. Sensitized RBL-2H3 cells (5 × 105) were resuspended in 50 μL of serum-free medium and stimulated with 1 μg/mL DNP-HSA

for 30 min at 37°C. Endocytosis was STA-9090 stopped by addition of 0.1% NaN3 in cold PBS for 5 min. Samples were labeled with FITC-conjugated anti-mouse IgE and the cytofluorimetric analysis was performed with a FACSCalibur flow PLX3397 datasheet cytometer (Becton Dickinson Immunocytometry Systems). Cells (120 × 103/well) were grown on glass coverslips coated with 2% gelatin, incubated with anti-DNP IgE (0.3 μg/well) overnight and stimulated with 500 or 50 ng/mL DNP-HSA for the indicated lengths of time to induce receptor internalization. Cells were then fixed, permeabilized, and stained with FITC-conjugated anti-IgE, as previously described [11]. To identify late

endosomes and lysosomes, cells were incubated with 300 nM Lyso-Tracker Red for the last 30 min during stimulation. www.selleck.co.jp/products/Paclitaxel(Taxol).html Images were acquired at room temperature using an ApoTome Observer Z.1 microscope (Carl Zeiss, Jena, Germany) with a Plan-Neofluar objective x40/0.75 and an Axiocam MRm camera (all from Carl Zeiss). ApoTome Zeiss system provides an optical slice view reconstructed from fluorescent samples using a series of “grid projection” acquisitions, as reported [11]. Imaging stacks in the axial direction were acquired using AxioVision 4.6.3 software (Carl Zeiss), and all images shown are from a representative axial plane. Colocalization of the fluorescence signal was analyzed with AxioVision 4.6.3 software (Carl Zeiss). Images were processed with Photoshop 7 (Adobe, San Jose, CA, USA). The bands from immunoblot were quantified by densitometric analysis performed using Image J statistical software (National Institutes of Health, Bethesda, MD, USA). Data are presented as mean ± SD and compared using one-way analysis of variance followed by Student’s t-test. A p-value less than 0.05 was considered as statistically significant. We thank G. Benigni for isolating mouse bone marrow cells, G. Bernardini and A. Kettner for technical advises for BMMC culture, P. Birarelli and B. Milana for technical assistance, and P. Di Russo for secretarial assistance.