In order to evaluate these two vector candidates, we further engineered these otherwise isogenic strains to express an identical Influenza A heterologous antigen from a chromosomally located gene fusion. The intent of the study was to evaluate the safety of the vectors by the oral route, and determine in a translational study whether human immune responses to a vectored viral antigen could be detected.

Influenza A nucleoprotein (NP) was chosen as a model viral antigen, as it has been evaluated previously selleck inhibitor as a conserved, and potentially cross-protective, vaccine antigen for influenza (11–13). Influenza A NP has been successfully expressed in L. monocytogenes (2, 14) and, as a component of both live and killed influenza vaccines given to millions, is likely safe to administer to volunteers. An Influenza A NP gene segment was chosen to include known human T cell epitopes (15, 16). Additionally, a well-studied nine-amino-acid epitope of the Influenza A M1 matrix protein recognized by HLA-A2 humans was included, GILGFVFTL (17), as HLA-A2 is a frequent haplotype

PD-0332991 in vivo in our North American Caucasian volunteer population. We report here the preclinical and clinical evaluation of the two vector strains BMB72 (ΔactA/plcB-NP) and BMB54 (ΔactA/inlB-NP). This Phase 1 clinical study was performed to further evaluate and compare two listerial vectors, and is not intended as a step towards commercialization of these vaccine strains or generation of an oral influenza vaccine. All the L. monocytogenes strains used in this study are derived from the streptomycin-resistant L. monocytogenes strain 10403S (18). Table 1 contains a list of the bacterial strains used to engineer the recombinant strains and their origins. The Influenza A gene fusions were constructed by generating a synthetic polynucleotide coding for the GILGFVFTL epitope of the influenza A M1 protein that was ligated to DNA encoding a 297-amino-acid portion of the Influenza A NP and cloned into the pEJ140PhoA vector (a gift from Jeff F. Miller at the University of California, Los Angeles, CA, USA). The Influenza A nucleoprotein segment was constructed by PCR amplification from a L. monocytogenes

Mirabegron strain (DPL1659; a gift from Daniel Portnoy at the University of California, Berkeley, CA, USA) that expresses amino acids 1–480 of the Influenza A nucleoprotein (Influenza A/PR/8/34) using primers (5′-to-3′) TTGGATCCCCAGGGTTCGACTCCT and GGGCGCGCCGGAGGCCCTCTGTTG. The modified pEJ140PhoA plasmid was then digested with NotI and the fragment containing the Influenza A NP fusion protein was ligated into the NotI site of a modified pPL2 site-specific integration vector (19). The resulting plasmid was then transformed into Escherichia coli SM10 (20) and subsequently mated into, and then plasmid sequences cured from, the attenuated background L. monocytogenes strains. Three nested segments of nucleoprotein of increasing size were evaluated for expression.