, 1998). In addition, the caspase-3-selective inhibitor, z-DEVD-FMK, which blocked T cell proliferation ( Alam et al., 1999), was subsequently shown to have little effect in other studies ( Boissonnas et al., 2002, Kennedy

et al., 1999 and Mack and Hacker, 2002). In the present study we examined the immunosuppressive properties of the peptidyl-FMK caspase inhibitors, z-VAD-FMK and z-IETD-FMK, and determined whether their inhibition of mitogen-induced T cell proliferation is due to the blocking of caspase processing during T cell activation. Our results showed that both caspase inhibitors readily block T cell proliferation induced by mitogens as well as IL-2. However, these peptidyl-FMK caspase inhibitors had little effect on the processing of caspase-8 and caspase-3 to their respective subunits during T cell activation although they efficiently Bioactive Compound Library supplier blocked caspase activation during apoptosis. Taken together, these results suggest that the inhibition of T cell proliferation mediated by these caspase inhibitors is independent of their caspase inhibition properties. Benzyloxycarbonyl-Val-Ala-Asp-(O-methyl)-fluoromehylketone (z-VAD-FMK), benzyloxycarbonyl-Ile-Glu-Thr-Asp-fluoromethylketone (IETD-FMK) Ion Channel Ligand Library cell assay and benzyloxycarbonyl-Phenyl-Alanyl-acid-fluoromethylketone (z-FA-FMK) were purchased from ICN (USA). Monoclonal antibody (mAb)

against CD3 (clone OKT3) was purified from hybridoma (ATCC) culture supernatants and anti-CD28 mAb was purchased from R & D (UK). Goat-anti caspase-8 was from Santa Cruz Biotechnology (USA) and rabbit anti-caspase-3 was generous gift from Xiao-Ming Sun, MRC Toxicology Unit (UK). FITC-conjugated anti-CD25 and RPE-conjugated anti-CD69 were acquired

from Transduction Laboratories (UK) and Dako (UK), respectively. Recombinant Fas ligand (FasL), anti-Flag and anti-PARP were obtained from Alexis nearly Biochemicals (UK). [3H]-thymidine was obtained from Amersham (UK) and phytohaemaglutinin (PHA) was purchased from Sigma (UK). MACS columns and MACS beads conjugated with anti-CD4 and anti-CD8 were obtained from Miltenyi Biotec (Germany). Lymphoprep was from Axis-Shield PoCAS (Norway) and RPMI 1640 and FCS were from Gibco (UK). Hoechst 33358 and carboxyfluorescein diacetate succinimidyl ester (CFSE) were from Molecular Probes (USA). Peripheral venous blood was obtained from normal healthy volunteers and collected into heparinized Vacutainers (Becton Dickinson). Peripheral blood mononuclear cells (PBMCs) were isolated using density gradient centrifugation with lymphoprep. The cells at the interface between the plasma and lymphoprep were collected, washed and re-suspended in RPMI containing 10% (v/v) foetal calf serum (FCS), 10 mM L-glutamine (Invitrogen, UK), penicillin (100 U/ml) and streptomycin (100 μg/ml).

In particular, prematurity, bronchopulmonary dysplasia and congenital heart disease are well known risk factors for severe RSV infection. In addition, it has been shown that patients with other conditions such as immunodeficiencies, Down’s syndrome and neuromuscular PI3K inhibitor diseases are also at significant risk of severe RSV disease according to a nationwide survey on the status of RSV infections in Japan conducted by Mori et al. [1], which is in agreement with other reports outside Japan 2 and 3. Both the innate and adoptive immune systems, and respiratory function in terms of anatomical, histological and physiological factors, influence the course of RSV infection in such

high risk groups find more in a complex manner. The humanized monoclonal antibody

Palivizumab specific for an epitope in the A antigenic site of the F protein of RSV was approved in Japan for prevention of severe RSV infections in premature babies, bronchopulmonary dysplasia and congenital heart disease, but at that time other high risk groups such as patients with immunodeficiencies, neuromuscular disorders, or chromosomal abnormalities were not included. Therefore, an application for additional indications for Palivizumab use in immunocompromised children and Down’s syndrome was submitted to the Ministry of Health, Labour and Welfare. After examination by the “Review Conference on Unlicensed and Adapted Medicine Highly Necessary for Medical Care”, this application was endorsed and a clinical trial was conducted. In August 2013, two new indications for Palivizumab use in children with immunocompromised conditions and Down’s syndrome were approved. This article reviews the literature related to RSV infections in immunodeficiencies and Down’s syndrome and outlines risk assessment for severe RSV infections. Based

on this review, clinical guidance for prevention of RSV infections through the use of Palivizumab Leukocyte receptor tyrosine kinase were formulated by expert opinion consensus for the purpose of determining the appropriate use of Palivizumab. Because of the heterogeneous nature and complexity of immunodeficiency disorders, however, these guidelines may not fully cover all of them equally well. Thus, it is necessary to personalize prophylaxis for the prevention of RSV infections based on the individual child’s immunity, risk of exposure to RSV, and anatomical and physiological condition of the respiratory system. Children with Down’s Syndrome or immunocompromised newborn babies, infants and children under the age of 24 months at the beginning of the RSV season have been recently added to those with an indication for the use of prophylactic Palivizumab. Here, we describe these new indications in the following sections.

Gram-negative bacilli were identified by biochemical testing (triple sugar iron agar, motility, lysine decarboxylase, indole production, citrate and urea utilization) or API 20E (bioMérieux, Marcy l’Etoile, France). Putative S. enterica isolates were confirmed by agglutination with specific antisera (Bio-Rad, Hemel Hempstead, Hertfordshire, UK). Antimicrobial susceptibilities

were performed at the time of isolation by a modified Bauer-Kirby disc diffusion method, inhibition zone sizes were recorded and interpretations of the zone sizes were based on the latest CLSI guidelines.12 The antimicrobials tested (Oxoid) were chloramphenicol (30 μg), ampicillin (10 μg), trimethoprim–sulphamethoxazole http://www.selleckchem.com/products/Vincristine-Sulfate.html (1.25/23.75 μg), ceftriaxone

(30 μg), ciprofloxacin (5 μg), azithromycin (15 μg) and nalidixic acid (30 μg). Isolates were stored in Tryptic Soy Broth with 20% glycerol at −80 °C. A representative selection of 102 stored S. enterica Typhi isolates were later subcultured and the minimum inhibitory concentration (MIC) determined by E-test strips according to the manufacturer’s guidelines (AB Biodisk, Solna, Sweden). The evaluated antimicrobials were ciprofloxacin, gatifloxacin, ceftriaxone and azithromycin. Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923 were used as control strains for these assays. An isolate was defined as MDR if it was resistant to all of the following: chloramphenicol (≥32 μg/ml), ampicillin (≥32 μg/ml) MYO10 and trimethoprim/sulfamethoxazole (≥8/152 μg/ml). Intermediate susceptibility to ciprofloxacin (formerly known as decreased ciprofloxacin susceptibility) was defined selleckchem by an MIC of 0.12–0.5 μg/ml and resistance

by an MIC of ≥1 μg/ml. 12 The equivalent values for gatifloxacin were 4 μg/ml and ≥8 μg/ml and for ceftriaxone 2 μg/ml and ≥4 μg/ml. There are no recommended CLSI breakpoints for azithromycin against Salmonella. We sought to distinguish the H58 serovar Typhi strains, as these are the most common and ubiquitous across Asia, from non-H58 strains by inferring genotype though the detection of the H58-specific single nucleotide polymorphism (SNP) using a modified pyrosequencing technique. Salmonella Typhi belong to haplotype H58 if the SNP at nucleotide 252 on the gene glpA (corresponds to STY2513 from GenBank accession no. AL513382, Salmonella Typhi CT18) is T, otherwise they belong to non-H58. 13 The common SNPs inducing intermediate susceptibility to ciprofloxacin, located at position 83 and 87 in the gyrA gene and position 80 in the parC gene, were also determined by modified pyrosequencing. 7 Genomic DNA was prepared from the bacterial isolates using the Wizard genomic DNA purification kit (Promega, Madison, WI, USA). The prepared DNA was PCR amplified using the following primer pairs targeting the regions containing the H58 SNP: forward primer 5′biotin GTAACGTCAGCCGCGGTATT; reverse primer 5′ GCCATCAGGCGATAAGTCATTA 3′.

The study of recurrence, functional significance and clinical Epacadostat research buy impact of these mutations

is expected to be a costy and time consuming process. The large bulk of experimental and clinical work necessary to characterize a genetic lesion expressed at low frequency (about 4% of AML) is exemplified by BCOR mutations. 129 Two driver mutations are expected to be mutually exclusive in the same cellular clone under two circumstances: i) redundancy (selection of two hits in the same pathway does not occur because they do not provide a growth advantage); and ii) synthetic lethality (counter-selection of two hits because they compromise the survival of the leukemic cell). Sinergistic associations can occur in all other cases. Overall, two major associations are observed in AML. Cooperation of ASXL1 and RUNX1 mutations is typical of secondary, dysplastic AML, whilst the association of NPM1 mutations with those involving the DNMT3A and/or IDH1 and/or FLT3 genes seems

to characterize selleckchem most de-novo AML with normal cytogenetics. 142 Because the mutational landscape of CN-AML is not yet fully defined, it is expected that the discovery of novel mutations through NGS will further contribute to a better understanding of leukemogenic pathways. As an example, the association of DNMT3A with BCOR mutations 129 appears to define a small subset of patients with CN-AML that were previously molecularly poorly characterized. There is growing evidence that more than Dichloromethane dehalogenase one hit is necessary to trigger AML. This concept seems to apply not only to cases where several genetic hits can be clearly documented but also to those that apparently harbor a single mutation. In fact, the latter cases could well carry other yet undiscovered

mutation(s). Assuming that AML requires several hits to develop, the question then raises about the role of the different mutations in the process of leukemogenesis. A first step in leukemogenesis is likely to represent just a clonal expansion. The most likely candidate to play this role as initiating genetic event in the majority of de-novo AML with normal cytogenetics is NPM1 mutations ( Fig. 1). 14 Instead, gene mutations that frequently associate with NPM1-mutated AML, such as those affecting the FLT3, DNMT3A and IDH1 genes, are likely to represent secondary events that are mainly involved in tumor progression. 14 Recent findings, including those derived from NGS studies, clearly indicate that AML development may be a more complex process than that previously hypothesized based on the minimal cooperation of two oncogene classes: driving proliferation (kinases, RAS) and blocking differentiation (e.g. transcription factors).143 An alternative “slot machine” model144 has been proposed in which the late steps would be, to some point, constrained by the initial ones (clonal dominance, cooperations/exclusions).

Iron metabolism has been found to be significantly disturbed in type 2 diabetes and interferes with glucose metabolism (Lee et al., 2006b). Lowering iron pools generally improves insulin sensitivity. In addition, iron has been strongly implicated in nonalcoholic steatohepatitis, considered an early marker of insulin resistance (Machado and Cortez-Pinto, 2006). Elevated iron levels can predispose to coronary disease and myocardial infarction. Hypertension is believed to be a common risk factor of cardiovascular disease, related to metabolic syndrome and obesity, mediated

mainly by elevated levels of ROS in which iron plays a key role (LaMarca et al., 2008). Gefitinib Positive effects of iron depletion in women due to menstruation have

been associated with the lowering risk of cardiovascular-disease that disappears in post-menopause. Cardiovascular disease is a multifactorial disorder in which lipid metabolism, life style (smoking, stress), coronary artery disease and others play their concerted roles (Touyz and Schiffrin, 2004). It has been GSK1120212 datasheet communicated that iron mediated formation of superoxide radical and hydroxyl radical during development of heart disease, mainly during reperfusion injury, can be inhibited by iron chelators. Anemia is a potential risk factor and has been associated with heart failure (Mozaffarian et al., 2003 and Bolger et al., 2006), pointing to a role for dysregulation of iron metabolism. This points to the necessity of our understanding that exact speciation of iron in chronic anemias is linked to inflammatory diseases (Weiss and Goodnough, 2005). Atherosclerosis is an inflammatory condition accompanied by the accumulation of iron and oxidized lipids and fibrous elements in arteries as plaques. There is a correlation between iron status and atherosclerosis; free or poorly ligated iron can participate in lipid peroxidation

and protein peroxidation. The iron levels found in plagues correlated with the amount of oxidized proteins. Electron Paramagnetic Resonance (EPR) has been employed to demonstrate Farnesyltransferase that atherosclerotic tissue contained 17 times more iron (EPR detectable ferric) than equivalent healthy tissue (Stadler et al., 2004). Transition metal ions have been implicated in etiology of neurodegenerative disorders (Bush, 2003). Dysregulation of brain iron (and also copper, see below) homeostasis is a key factor to early neuropathological events in Alzheimer’s disease (AD), including oxidative stress, inflammatory processes, amyloid β deposition, tau phosphorylation, and neuronal cell cycle regulatory failure, leading to apoptosis (Bush and Curtain, 2008).

1% (48 of 133) with placebo/PR (Table 2, Figure 1A). The difference between the 2 groups (controlling for HCV 1 subtype and IL28B genotype as stratification factors) was statistically significant at 43.8% (95% CI, 34.6–53.0; P < .001). The majority of simeprevir-treated patients (92.7%; 241 of 260) met RGT criteria to complete treatment at week 24, of whom 83.0% (200 of 241) achieved

SVR12. Among simeprevir-treated patients who did not meet RGT criteria, 40.0% (6 of 15) achieved SVR12. The RVR rate was 77.2% (200 of 259) in the simeprevir/PR group compared with 3.1% (4 of 129) treated with placebo/PR. Among simeprevir-treated patients who achieved RVR, 86.5% (173 of 200) subsequently achieved SVR12. At week 4, 5% (12 of 260) of simeprevir-treated patients had HCV-RNA level of 25 IU/mL or greater. Irrespective

of factors such as baseline click here HCV-RNA level, IL28B genotype, METAVIR score, and HCV subtype, SVR12 rates were significantly higher in the simeprevir/PR group than in the placebo/PR group (all P < .001) ( Table 3, Figure 1B). In simeprevir-treated patients with HCV genotype 1a infection, the presence of the Q80K polymorphism at Navitoclax molecular weight baseline was associated with a lower SVR12 rate compared with those without this polymorphism at baseline (46.7% [14 of 30] vs 78.5% [62 of 79], respectively). However, the SVR12 rate was high among the 13 simeprevir-treated patients with baseline Q80K polymorphism who achieved RVR (76.9% vs 23.5% among patients without RVR). Only one simeprevir-treated patient with HCV genotype 1b infection had Q80K polymorphism at baseline; this patient achieved acetylcholine SVR12. The

possible effect of baseline characteristics and early response parameters on SVR12 in the simeprevir/PR group is presented in Supplementary Table 1. The rate of on-treatment failure was 3.1% (8 of 260) for simeprevir/PR and 27.1% (36 of 133) for placebo/PR (Table 2). Five patients (1.9%) in the simeprevir/PR group and 93 patients (69.9%) in the placebo/PR group met the virologic stopping rule at week 4, which dictated stopping simeprevir/placebo only and continuing with PR. Respective proportions of patients meeting a virologic stopping rule requiring discontinuation of all treatment at weeks 12, 24, or 36 were 1.9% (5 of 260) and 11.4% (15 of 133) in the simeprevir/PR and placebo/PR groups. Viral breakthrough occurred in 2.3% (6 of 260) of simeprevir-treated patients; this rate was similar in patients infected with genotype 1a/other (2.7%) and genotype 1b (2.0%). No placebo-treated patients had viral breakthrough. Viral breakthrough occurred mainly during the first 12 weeks of treatment with simeprevir/PR, and 5 of 6 simeprevir-treated patients with viral breakthrough also met a virologic stopping rule. Among patients with undetectable HCV RNA at EOT, 18.5% (46 of 249) in the simeprevir/PR group and 48.4% (45 of 93) in the placebo/PR group had experienced viral relapse.

67 × 1012 m2, cp equal to 4200 J(kg °C)− 1, and calculating the long-term mean in- and outflows and associated temperatures from the model (Qin, Tin, Qout, Tout = 1.16 × 106 m3 s− 1, 18.1 °C, 1.14 × 106 m3 s− 1 15.32 ° C), we obtain an average Floss of 9 W m− 2; this is in accordance with the value presented in Table 2 and indicates that the net heat loss at the surface was compensated for by the heat transported through the Sicily Channel. Finally, to evaluate the modelling approach, the heat and salt contents of the whole EMB water column changes were simulated using the PROBEEMB model and compared

with observations from the MEDAR ocean database (Figure 16). The comparison indicates a close correlation, with the calculated total heat content deviating approximately 1% from the MEDAR value. For the salt Selleckchem Selumetinib content, the modelled value deviates by less than 0.3% from the MEDAR value. The PROBE-EMB can realistically reproduce the water and heat balances of the EMB. The connection between atmospheric conditions over the Mediterranean Basin and the large-scale atmospheric circulation in the Northern Hemisphere is generally strong, for example, as represented by the North Atlantic Oscillation (NAO). There is a

significant link (R = 0.45, n = 52) between winter precipitation over the EMB and the NAO (data not shown Lumacaftor but available from the National Oceanic and Atmospheric Administration – NOAA – database). Moreover, there is a link (R = 0.3, n = 52) between winter NAO and winter evaporation. Wet (dry) winters are associated with positive (negative) NAO index values. On the other hand, negative (positive) NAO index

values are associated with increased (decreased) evaporation rates in the winter. Changes in the NAO index greatly affect the winter water and heat balances of the EMB, which is in agreement with, for example, the results of Turkes, 1996a and Turkes, Calpain 1996b. The study analyses the large-scale features of the EMB using ocean modelling and available meteorological and hydrological datasets. Local features (e.g., the Eastern Mediterranean Transient, EMT) are therefore not included. It is a budget-type method building on horizontal averaging, i.e. strong local forcing might trigger convections that reach the bottom, while the same forcing averaged over the whole basin may have a minor influence. In the future, we will model the EMB as a number of sub-basins and also address local EMB features that may influence the water and heat balances. For example, the Southern Aegean Basin is significantly affected by deep water formation and needs to be considered when modelling deep water formation. The individual terms of the water and heat balances were analysed together with how the climate change signals affect the heat and water cycles. Individual water and heat component values are presented in figures and tables.

The condition of all the biodiversity and ecosystem health components assessed, pooled across all regions and all Selleck Bleomycin indicators, is Good (median value = 7; Table 2). The Best10% of the components is Very Good (median value = 9), Most components is Good (median value = 7) and

the Worst10% of components is Poor (median value = 4.5) (Table 3). The distribution of the pooled condition estimates showed a clear spatial pattern—the N region was considered in the best condition relative to the other regions, whereas the SE region was considered to be in the worst condition. The highest median scores for biodiversity and ecosystem health for each of the three indicators (Best10%, Most, Worst10%) and the smallest range of medians between Best10% and Worst10% were found in the N region. This suggests a limited extent and amount of degradation, as well as high levels of condition quality of the biodiversity and ecosystem health components across most of the N region. In contrast, the lowest median scores for the indicators Best10% and Most, and the equal lowest (with East (E) region) for Worst10% were found in the SE region

(Fig. 2a). The biodiversity index is highest in the N region and lowest in the SE region. The dominant current trend feature of the regions is that the biodiversity and ecosystem health condition was broadly stable—66% of components and their indicators were assessed as Stable across all the regions (Table 3). However, in the South-west (SW), North-west (NW) and E regions more than 30% of trend observations KU-60019 for biodiversity and ecosystem health components were considered to be Deteriorating (Fig. 2c). The N region has the lowest proportion of biodiversity components in decline (10% observations). The SW region has a high proportion of components Deteriorating (39% observations), but also demonstrates the greatest proportion of components (12% observations) that are Improving

in condition. In the remaining regions, 6% or less of the component observations were considered to be Improving. Over Racecadotril the national marine jurisdiction as a whole, many more biodiversity components are considered to be Deteriorating (28% observations) than are Increasing in condition (6% observations) (Table 3). Eighty-eight components were found to be in decline in at least one indicator, and of these, 24 components had a frequency of 5 (the 75th percentile of frequency of Deterioration) or more observations of Deterioration across all indicators and all regions (Table 4). The components in most extensive decline included a range of habitats (6) and species groups (3), but mainly (proportionally) comprised ecological processes (8) and physical and chemical processes (6).

Relative quantification of mRNA levels was obtained by the 7500 system software, which uses the comparative

method (ΔCT). Primers and TaqMan probes specific for GHSR-1a and actin were obtained from ABI TaqMan Gene Expression Assay catalog (Foster City, CA, USA). This assay comes in a 20× reaction mix, spans an exon–exon junction, and is optimized to give ∼100% efficiency. Results are expressed as mean ± S.E.M. Torin 1 research buy The GraphPad Prism 5 program (GraphPad softwares, Inc., La Jolla, CA, USA) was used for statistical analyses and graphics. Statistical significance was determined by Student’s t-test for unpaired, bilaterally distributed values of equal variance. P < 0.05 was considered statistical significant. Statistical analyses of body weight data were conducted using the Statistical Analysis System

(SAS) version 9.1. An analysis of repeated measurements was conducted using mixed effects (procedure proc mixed in SAS) to test the differences between groups and over time. The body weight of SL and NL Swiss mice from the day of birth to adulthood (180 days of age) were measured. Animals were weighed periodically, and our data demonstrated that the SL mice were significantly heavier when compared to the NL mice (P < 0.0001) since the 10th day of life. This difference was higher (P < 0.0001) in all measured ages until 180 days MK-2206 price of age, and persisted, representing 35.6% of weight gain at 180 days of age ( Fig. 1). These data was confirmed to body weight to tibia length ratio where SL presented higher value than NL group (P < 0.0001) ( Table 1). In accordance with the changes observed in total body weight, visceral fat weight in SL mice was found to be 78.2% higher relative to NL at 180 days of age (Fig. 2). Our data also showed that in the SL mice, heart weight was also increased, and that hearts of SL mice were 23.5% heavier than those of NL mice. Corroborate with these results the heart weight to tibia length and left ventricle were also significantly Ribociclib larger in SL than NL mice (P < 0.0001) ( Table 1).

The microscopic parameters of the myocardium were analyzed and SL mice displayed cardiomyocyte hypertrophy, as evidenced by higher cardiomyocyte area (A[cmy]) compared to the NL (P < 0.01) ( Fig. 3). Regarding the myocardial vascularization, the results of the two parameters Lv[ima] and [ima]/[cmy], which are important measurements to determine myocardial vitality, showed that the intramyocardial vessel density was more than 100% minor in the SL group ( Table 2). The volume density of connective tissue (VV [ct]) was significantly greater in SL than in NL group (P < 0.01) ( Table 2). In the myocardial of SL group the cardiomyocyte hypertrophy was accompanied to increase of connective tissue and decrease vascularization ( Fig. 4). There were significant effects of overnutrition during the neonatal suckling period on liver weight. Table 1 also shows the SL group had greater liver weights (42.

In conclusion, poor outcome from pneumococcal meningitis in Malawi is likely to be multifactorial selleck chemicals and our data

suggest that anti-cytokine adjunctive treatments in sub-Saharan Africa are unlikely to be effective. Alternative strategies such as pneumococcal vaccination in HIV infected adults, reducing pre-hospital delays to treatment, optimising in-hospital care, investigating alternative adjunctive treatments targeting pneumococcal toxins and optimising macrophage phagocytosis13, 23, 25, 26 and 27, should be on-going research priorities. The bacterial load work was funded by the Wellcome Trust (CDF 061231 and 089671/B/09/Z) (Clinical PhD fellowship to EW) and NIHR Biomedical Research funding to SG. The cytokine analysis was funded by the Wellcome Trust (Research fellowship to SBG). The steroid and glycerol adjunctive therapy studies were funded by the Meningitis Research Foundation. Neither the funding bodies nor

the trial sponsors had any role Selleck TGFbeta inhibitor in the laboratory work, data analysis, manuscript preparation or decision to publish. The authors declare no conflicts of interest. We are grateful for the assistance of Professor Ray Borrow and Dr Malcolm Guiver of Public Health England meningitis reference laboratory for verifying the CSF bacterial load data. We thank Professor Tom Solomon for his help in obtaining ethical permission for the acquisition of normal CSF to validate the bacterial load assay and Chris Ambrose for his assistance with the laboratory work. Professor. J. Weiser kindly donated purified genomic DNA for the standard curves. “
“Staphylococcus aureus is an important cause of infections in both primary and secondary care. Carriage prevalences of ∼30% have been found consistently in studies

performed over six decades, 1 with the anterior nares the primary site of colonisation. 1, 2 and 3 Nasal carriers are at greater risk of infection than non-carriers 4, 5, 6 and 7 and the carried and invasive strains are indistinguishable in ∼80% of cases. 5 and 8 Non-carriers of S. aureus have a higher mortality following S. aureus bacteraemia DOCK10 suggesting recent S. aureus acquisition around the time of infection is associated with poorer subsequent outcome. 5 The dynamic nature of S. aureus carriage creates complexity for cross-sectional and longitudinal studies, with people acquiring and losing all genotypes of S. aureus (the species level) and also acquiring and losing different genotypes within S. aureus. 9 For example, one study found multiple genotypes were present in 7% of carriage samples. 10 Rather than considering S. aureus loss and acquisition as separate events, studies have almost universally combined both these aspects and classified individuals as “persistent”, “intermittent” or “non” carriers.