Gram-negative bacilli were identified by biochemical testing (triple sugar iron agar, motility, lysine decarboxylase, indole production, citrate and urea utilization) or API 20E (bioMérieux, Marcy l’Etoile, France). Putative S. enterica isolates were confirmed by agglutination with specific antisera (Bio-Rad, Hemel Hempstead, Hertfordshire, UK). Antimicrobial susceptibilities

were performed at the time of isolation by a modified Bauer-Kirby disc diffusion method, inhibition zone sizes were recorded and interpretations of the zone sizes were based on the latest CLSI guidelines.12 The antimicrobials tested (Oxoid) were chloramphenicol (30 μg), ampicillin (10 μg), trimethoprim–sulphamethoxazole http://www.selleckchem.com/products/Vincristine-Sulfate.html (1.25/23.75 μg), ceftriaxone

(30 μg), ciprofloxacin (5 μg), azithromycin (15 μg) and nalidixic acid (30 μg). Isolates were stored in Tryptic Soy Broth with 20% glycerol at −80 °C. A representative selection of 102 stored S. enterica Typhi isolates were later subcultured and the minimum inhibitory concentration (MIC) determined by E-test strips according to the manufacturer’s guidelines (AB Biodisk, Solna, Sweden). The evaluated antimicrobials were ciprofloxacin, gatifloxacin, ceftriaxone and azithromycin. Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923 were used as control strains for these assays. An isolate was defined as MDR if it was resistant to all of the following: chloramphenicol (≥32 μg/ml), ampicillin (≥32 μg/ml) MYO10 and trimethoprim/sulfamethoxazole (≥8/152 μg/ml). Intermediate susceptibility to ciprofloxacin (formerly known as decreased ciprofloxacin susceptibility) was defined selleckchem by an MIC of 0.12–0.5 μg/ml and resistance

by an MIC of ≥1 μg/ml. 12 The equivalent values for gatifloxacin were 4 μg/ml and ≥8 μg/ml and for ceftriaxone 2 μg/ml and ≥4 μg/ml. There are no recommended CLSI breakpoints for azithromycin against Salmonella. We sought to distinguish the H58 serovar Typhi strains, as these are the most common and ubiquitous across Asia, from non-H58 strains by inferring genotype though the detection of the H58-specific single nucleotide polymorphism (SNP) using a modified pyrosequencing technique. Salmonella Typhi belong to haplotype H58 if the SNP at nucleotide 252 on the gene glpA (corresponds to STY2513 from GenBank accession no. AL513382, Salmonella Typhi CT18) is T, otherwise they belong to non-H58. 13 The common SNPs inducing intermediate susceptibility to ciprofloxacin, located at position 83 and 87 in the gyrA gene and position 80 in the parC gene, were also determined by modified pyrosequencing. 7 Genomic DNA was prepared from the bacterial isolates using the Wizard genomic DNA purification kit (Promega, Madison, WI, USA). The prepared DNA was PCR amplified using the following primer pairs targeting the regions containing the H58 SNP: forward primer 5′biotin GTAACGTCAGCCGCGGTATT; reverse primer 5′ GCCATCAGGCGATAAGTCATTA 3′.