Bacteria were cultured at 37°C in Luria-Bertani medium supplemented with 3% (w/v) NaCl (LBN) and the addition of 1.5% (w/v) agar where appropriate. The human epithelial intestinal Caco-2 and cervical HeLa cell lines were obtained from the DSMZ (German Collection of Microorganisms and Cell Cultures). Caco-2 cells were grown as a monolayer in Dulbecco’s Combretastatin A4 concentration Modified Eagle’s Medium (DMEM) supplemented with 2 mM L-glutamine (Gibco), Pen-Strep (100 units/ml penicillin, 100 μg/ml streptomycin, (Gibco), 1% non-essential this website amino acids (Gibco) and 20% (v/v) Foetal Bovine Serum (Gibco) at 37°C, 5% CO2. All materials used were purchased from Sigma, unless otherwise stated. Measurement of absorbance

of samples in 96-well plates was performed using a Tecan Sunrise and Magellan software. Construction of deletion mutant strains Molecular biology techniques MRT67307 purchase were performed according to Sambrook and Russell [55]. PCR reagents were obtained from Bioline, DNA purification kits and molecular biology enzymes from Promega and oligonucleotides from MWG/Eurofins. The standard PCR reaction volume was 50 μl, containing 50 ng template DNA, 400 nM each primer and 1× Polymerase Mix (Bioline). 1st round PCR reactions in the

overlap extension method were performed with Accuzyme polymerase and the standard PCR conditions were 3 min at 95°C (1 cycle), 30 sec at 95°C, 30 sec at 58°C, 2 min/kb at 68°C (30 cycles), 5 min at 68°C (1 cycle). Other PCR reactions were performed with Taq polymerase, and an extension time and temperature of 30 sec/kb and 72°C, respectively. In some cases the annealing temperature was optimised for a specific PCR reaction. In-frame deletion mutations were constructed in the vscN genes of each of the V. parahaemolyticus TTSS in order to inactivate each of these secretion systems independently. As the vscN gene encodes the ATPase that powers the secretion process, mutation of this gene eliminates secretion. The TTSS1-associated VscN1 is encoded by vp1668 and TTSS2-associated VscN2 is encoded by vpa1338. Each mutant allele was

constructed by overlap PCR. The primers PrAB49 (AACGCGAACGCCACCGTC), PrAB50 (TCTGCTACGCGCTGCTTGAGC), PrAB51 ADP ribosylation factor (ACTTGCAGACAACTCTCCAACGCGTAC) and PrAB52 (GGAGAGTTGTCTGCAAGTCGAGTGATG) were used for generation of the vscN1 Δ142-1065 allele encoding VscN1Δ51-355. Primers PrAB45 (GCCATCAGGTCAAGTGCAAG), PrAB47 (TCTATAGCTATTTCACCGCGGATTCTC), PrAB48 (CGGTGAAATAGCTATAGAACGCTACCC) and PrAB59 (GTCTACCGTATCTCGAATGAATAGCG) were employed to generate the vscN2 Δ132-1154 allele encoding VscN2Δ45-385. The PCR products were cloned into pCR2.1 by TA topoisomerase cloning according to the manufacturer’s instructions (Invitrogen). The alleles were then transferred into the suicide vector pDS132 [56] by extraction with the restriction enzymes SacI and XbaI, for vscN1 and vscN2 respectively, followed by ligation into the corresponding restriction sites of pDS132.